{ "last_updated": "2026-05-30T19:17:44", "n_proteins": 210, "n_in_model": 74, "n_with_structure": 210, "n_with_plddt": 208, "n_with_evidence": 99, "proteins": [ { "gene": "CTNNB1", "name": "Beta-catenin", "diseases": [ "AA", "AGA", "CIA" ], "pathway": "Wnt/β-catenin", "twin_node": "Wnt", "effect": "+", "role": "protector", "drugs": [ "Wnt agonist", "Wnt/beta-catenin agonists (investigational)", "valproate", "valproic acid (GSK3 inhibition, off-label)" ], "mechanism": "Wnt 핵심 effector. anagen 유도·HFSC 활성의 중추.", "evidence_paper_ids": [ "39922517", "40672523", "41247552", "41317579", "41338418", "41392580", "41506142", "41561359", "41662901", "41692280" ], "n_evidence": 10, "mention_count": 9, "sources": [ "discover:AGA", "extract", "seed" ], "in_model": true, "uncertain": false, "structure": { "accession": "P35222", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/P35222", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-P35222-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-P35222-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/P35222", "mean_plddt": 81.1, "plddt_band": "Confident (70–90)", "n_residues": 781, "local_pdb": "digital_twin\\data\\structures\\P35222_AF.pdb" }, "uniprot": "P35222", "uniprot_name": "Catenin beta-1", "length": 781, "function": "Key downstream component of the canonical Wnt signaling pathway (PubMed:17524503, PubMed:18077326, PubMed:18086858, PubMed:18957423, PubMed:21262353, PubMed:22155184, PubMed:22647378, PubMed:22699938). In the absence of Wnt, forms a complex with AXIN1, AXIN2, APC, CSNK1A1 and GSK3B that promotes phosphorylation on N-terminal Ser and Thr residues and ubiquitination of CTNNB1 via BTRC and its subsequent degradation by the proteasome (PubMed:17524503, PubMed:18077326, PubMed:18086858, PubMed:18957423, PubMed:21262353, PubMed:22155184, PubMed:22647378, PubMed:22699938). In the presence of Wnt liga", "pdb_count": 47, "pdb_ids": [ "1G3J", "1JDH", "1JPW", "1LUJ", "1P22", "1QZ7", "1T08", "1TH1" ], "grounding": [ { "paper": "Improvement of androgenic alopecia by extracellular vesicles secreted from hyaluronic acid-stimulated induced mesenchymal stem cells", "quote": "licle dermal papilla cells undergoing testosterone-mediated AGA. Additionally, the expression of androgen receptor (AR) and relevant growth factors as well as key proteins of Wnt/β-catenin signaling pathway (β-catenin and phospho‑ rylated GSK3β) was analyzed. Subsequently, AGA was induced in male C5", "n_hits": 129 }, { "paper": "Restoration of follicular β-catenin signaling by mesenchymal stem cells promotes hair growth in mice with androgenetic alopecia", "quote": "omoted hair growth, HFs density, skin thickness, and anagen phase activation, while inhibiting DPCs apoptosis, and promoting HFSCs proliferation. In vitro, hUCMSCs activated Wnt/β-catenin signaling in DPCs via Wntless (Wls), while stimulating growth factor secretion and HFSCs proliferation. Blocking", "n_hits": 126 }, { "paper": "Low-frequency electromagnetic fields ameliorate testosterone-induced androgenetic alopecia in mice through LncRNA H19 miR-214-5p β-catenin signal pathway", "quote": "Low-frequency electromagnetic fields ameliorate testosterone-induced androgenetic alopecia in mice through LncRNA H19/miR-214-5p/β-catenin signal pathway Jiang-Hua Cheng a,1, Chong-You a,1, Ting Hu b,1, Wei-Jun Fang a, Xiao-Min Niu a, Ke-Tao Du a,* a Department of Rehabilitation Medicine, South Chin", "n_hits": 114 }, { "paper": "BFNB Enhances Hair Growth in C57BL 6 Mice through the", "quote": "rez-Mora, S.; Ocampo-López, J.; Gómez-García, M.d.C.; Pérez-Ishiwara, D.G. BFNB Enhances Hair Growth in C57BL/6 Mice through the Induction of EGF and FGF7 Factors and the PI3K-AKT-β-Catenin Pathway. Int. J. Mol. Sci. 2023, 24, 12110. https:// doi.org/10.3390/ijms241512110 Academic Editor: Izabela Gr", "n_hits": 77 } ], "grounded_in_corpus": true }, { "gene": "AR", "name": "Androgen receptor", "diseases": [ "AGA" ], "pathway": "Androgen signaling", "twin_node": "AND", "effect": "+", "role": "driver", "drugs": [ "GT20029 (Kintor, topical AR-PROTAC, Phase 2)", "RU58841", "RU58841 (clascoterone-class topical antiandrogens)", "bicalutamide", "clascoterone", "dutasteride (indirect)", "finasteride (indirect)", "finasteride(indirect)", "siRNA-AR", "spironolactone" ], "mechanism": "DHT 결합 핵수용체. AGA 의 중심 구동자; DKK1·TGFβ 전사 유도.", "evidence_paper_ids": [ "41247552", "41317579", "41328006", "41338418", "41506142", "41532459", "41603616", "41662901", "41714473", "41751951", "41769701", "PPR1134993" ], "n_evidence": 12, "mention_count": 6, "sources": [ "discover:AGA", "discover:recent", "extract", "seed" ], "in_model": true, "uncertain": false, "structure": { "accession": "P10275", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/P10275", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-P10275-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-P10275-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/P10275", "mean_plddt": 57.3, "plddt_band": "Low (50–70)", "n_residues": 920, "local_pdb": "digital_twin\\data\\structures\\P10275_AF.pdb" }, "uniprot": "P10275", "uniprot_name": "Androgen receptor", "length": 920, "function": "Steroid hormone receptors are ligand-activated transcription factors that regulate eukaryotic gene expression and affect cellular proliferation and differentiation in target tissues (PubMed:19022849). Transcription factor activity is modulated by bound coactivator and corepressor proteins like ZBTB7A that recruits NCOR1 and NCOR2 to the androgen response elements/ARE on target genes, negatively regulating androgen receptor signaling and androgen-induced cell proliferation (PubMed:20812024). Transcription activation is also down-regulated by NR0B2. Activated, but not phosphorylated, by HIPK3 an", "pdb_count": 94, "pdb_ids": [ "1E3G", "1GS4", "1T5Z", "1T63", "1T65", "1XJ7", "1XOW", "1XQ3" ], "grounding": [ { "paper": "The AR miR-221 IGF-1 pathway mediates the pathogenesis of androgenetic alopecia", "quote": "of AR, plays a crucial role in the pathogenesis of AGA, making it a novel biomarker and potential therapeutic target for treating AGA. Keywords: androgenetic alopecia; miR-221; androgen receptor; IGF-1; dihydrotestosterone Introduction Androgenetic alopecia (AGA), also known as male pattern baldness", "n_hits": 10 }, { "paper": "The Genetic Landscape of Androgenetic Alopecia Current Knowledge and Future Perspectives.", "quote": "ide association studies have defined AGA as a highly polygenic trait with dozens of loci of small to moderate effect. Early studies built on classic candidate gene findings at the androgen receptor (AR) locus and the 20p11 region, but expanded the architecture substantially [16,17]. A landmark GWAS ", "n_hits": 8 }, { "paper": "2,5-Diazabicyclo[2.2.1]heptane in medicinal chemistry a treasure trove of therapeutic opportunities.", "quote": "by modifying the ketone ring structure based on alectinib. The key compound (293) was obtained in a 54% yield and demonstrated potent ALK inhibition with an IC50 of 6.6 nM.225 The androgen receptor (AR), part of the nuclear hormone receptor superfamily, plays a vital role in both the development of ", "n_hits": 7 }, { "paper": "Dihydrotestosterone-induced hair regrowth inhibition by activating androgen receptor in C57BL6 mice simulates androgenetic alopecia", "quote": "ss article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/). Original article Dihydrotestosterone-induced hair regrowth inhibition by activating androgen receptor in C57BL6 mice simulates androgenetic alopecia Danlan Fu 1, Junfei Huang 1, Kaitao Li 1, Yuxin Chen, Ye ", "n_hits": 7 } ], "grounded_in_corpus": true }, { "gene": "SRD5A2", "name": "Steroid 5-alpha-reductase 2", "diseases": [ "AGA" ], "pathway": "Androgen signaling", "twin_node": "AND", "effect": "+", "role": "driver", "drugs": [ "dutasteride", "finasteride" ], "mechanism": "두피 모낭에서 T→DHT 전환의 주효소. finasteride 표적.", "evidence_paper_ids": [ "41552226", "41603616", "41622844", "41692280", "41714473", "41766440", "41769701", "41779757", "41779759" ], "n_evidence": 9, "mention_count": 5, "sources": [ "discover:AGA", "extract", "seed" ], "in_model": true, "uncertain": false, "structure": { "accession": "P31213", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/P31213", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-P31213-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-P31213-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/P31213", "mean_plddt": 94.4, "plddt_band": "Very high (≥90)", "n_residues": 254, "local_pdb": "digital_twin\\data\\structures\\P31213_AF.pdb" }, "uniprot": "P31213", "uniprot_name": "3-oxo-5-alpha-steroid 4-dehydrogenase 2", "length": 254, "function": "Converts testosterone (T) into 5-alpha-dihydrotestosterone (DHT) and progesterone or corticosterone into their corresponding 5-alpha-3-oxosteroids. It plays a central role in sexual differentiation and androgen physiology", "pdb_count": 1, "pdb_ids": [ "7BW1" ], "grounding": [ { "paper": "Use of genetics in the prediction of success in male pattern hair loss therapy and mechanistic studies.", "quote": "observations on LDOM dose response and concentration remain exploratory and should not yet inform clinical dose adjustment (Goren et al., 2014; Jimenez-Cauhe et al., 2025). 4.2 5-Alpha-Reductase inhibitors Type 1 and type 2 5α-reductase, encoded by SRD5A1 and SRD5A2, catalyse the conversion of testo", "n_hits": 41 }, { "paper": "Xiaozhi Yufa decoction ameliorates androgenetic alopecia through inhibition of MAPK signaling and regulation of lipid metabolism", "quote": "age-related changes (Xiao et al., 2025). Dihydrotestosterone (DHT) serves as the primary mediator of follicular miniaturization in genetically susceptible individuals. The enzyme 5α-reductase type 2 catalyzes the conversion of testosterone to DHT in hair follicles and sebaceous glands. DHT subsequen", "n_hits": 37 }, { "paper": "Black phosphorus nanosheets encapsulated microneedle for multifunctional therapy for androgenic alopecia", "quote": "ge 2 of 20 Xiong et al. Journal of Nanobiotechnology (2025) 23:147 heightened androgenic milieu and vascular insufficiency in the scalp. Specifically, the overexpressed 5α-reductase, increased androgen receptors (ARs), and elevated dihy- drotestosterone (DHT) production lead to the progres- sive min", "n_hits": 25 }, { "paper": "Stauntonia hexaphylla Extract Ameliorates Androgenic Alopecia by Inhibiting Androgen Signaling in Testosterone-induced Alopecia Mice", "quote": "Objectives: In this study, we evaluated the effects of an extract of S. hexaphylla on AGA models and its mechanisms of action. Methods: We studied S. hexaphylla extract to evaluate 5α-reductase and androgen receptor (AR) levels, apoptosis, and cell prolifer- ation in vitro and in vivo. In addition, p", "n_hits": 20 } ], "grounded_in_corpus": true }, { "gene": "VEGFA", "name": "Vascular endothelial growth factor A", "diseases": [ "AA", "AGA", "CIA" ], "pathway": "Growth factor", "twin_node": "DP", "effect": "+", "role": "protector", "drugs": [ "VEGF microneedle", "minoxidil (upregulates VEGFA)", "minoxidil(indirect)", "platelet-rich plasma (delivers VEGFA)" ], "mechanism": "모낭 혈관신생; anagen 영양 공급.", "evidence_paper_ids": [ "39922517", "41317579", "41561359", "41662901" ], "n_evidence": 4, "mention_count": 4, "sources": [ "discover:AGA", "extract", "seed" ], "in_model": true, "uncertain": false, "structure": { "accession": "P15692", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/P15692", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-P15692-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-P15692-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/P15692", "mean_plddt": 63.9, "plddt_band": "Low (50–70)", "n_residues": 395, "local_pdb": "digital_twin\\data\\structures\\P15692_AF.pdb" }, "uniprot": "P15692", "uniprot_name": "Vascular endothelial growth factor A, long form", "length": 395, "function": "Participates in the induction of key genes involved in the response to hypoxia and in the induction of angiogenesis such as HIF1A (PubMed:35455969). Involved in protecting cells from hypoxia-mediated cell death (By similarity)", "pdb_count": 56, "pdb_ids": [ "1BJ1", "1CZ8", "1FLT", "1KAT", "1KMX", "1MJV", "1MKG", "1MKK" ], "grounding": [ { "paper": "Hydrogel forming microneedles loaded with VEGF and Ritlecitinib,polyhydroxyalkanoates nanoparticles for mini-invasive androgenetic alopecia treatment", "quote": "alf of KeAi Communications Co. Ltd. This is an open access article under the CC BY license (http://creativecommons.org/licenses/by/4.0/). Hydrogel forming microneedles loaded with VEGF and Ritlecitinib/ polyhydroxyalkanoates nanoparticles for mini-invasive androgenetic alopecia treatment Yan-Wen Din", "n_hits": 45 }, { "paper": "Drug Delivery System Based On Minoxidil Nanoparticles Promotes Haira Growth in C57BL6 Mice", "quote": "pm, 30 s×15 times, intermittent milling). C57BL/6 mice were used to evaluate hair-growth effects. The expression levels of mRNA and protein for vascular endothelial growth factor (VEGF) and insulin-like growth factor-1 (IGF-1) were determined by real-time PCR and ELISA methods, respectively. Results", "n_hits": 35 }, { "paper": "ISEV2025 Abstract Book.", "quote": "which was further augmented with OCY-derived EVs. In particular, OCY-derived maEVs led to a significant increase in tube formation with thicker vessels present, comparable to the +VEGF control, and also increased HUVEC migration and proliferation. Remarkably, treatment with OCY-derived maEVs leads t", "n_hits": 29 }, { "paper": "Minoxidil delivered via a stem cell membrane delivery controlled release system promotes hair growth in C57BL6J mice", "quote": "and differential centrifugation, and their effects on hair growth were evaluated using C57BL/6J mice. The mRNA and protein expression levels of vascular endothelial growth factor (VEGF) and insulin-like growth factor-1 (IGF-1) were detected by real-time polymerase chain reaction and enzyme-linked im", "n_hits": 26 } ], "grounded_in_corpus": true }, { "gene": "BCL2", "name": "Apoptosis regulator Bcl-2", "diseases": [ "AGA", "CIA" ], "pathway": "Cell-cycle/apoptosis", "twin_node": "APO", "effect": "-", "role": "protector", "drugs": [ "Venetoclax (BCL2 inhibitor; opposing context)" ], "mechanism": "항-apoptosis; 과발현 시 UV 보호하나 catagen 촉진(양면).", "evidence_paper_ids": [ "39922517", "41371370", "PPR1134993" ], "n_evidence": 3, "mention_count": 3, "sources": [ "discover:CIA", "extract", "seed" ], "in_model": true, "uncertain": false, "structure": { "accession": "P10415", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/P10415", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-P10415-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-P10415-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/P10415", "mean_plddt": 72.0, "plddt_band": "Confident (70–90)", "n_residues": 239, "local_pdb": "digital_twin\\data\\structures\\P10415_AF.pdb" }, "uniprot": "P10415", "uniprot_name": "Apoptosis regulator Bcl-2", "length": 239, "function": "Suppresses apoptosis in a variety of cell systems including factor-dependent lymphohematopoietic and neural cells (PubMed:1508712, PubMed:8183370). Regulates cell death by controlling the mitochondrial membrane permeability (PubMed:11368354). Appears to function in a feedback loop system with caspases (PubMed:11368354). Inhibits caspase activity either by preventing the release of cytochrome c from the mitochondria and/or by binding to the apoptosis-activating factor (APAF-1) (PubMed:11368354). Also acts as an inhibitor of autophagy: interacts with BECN1 and AMBRA1 during non-starvation condit", "pdb_count": 46, "pdb_ids": [ "1G5M", "1GJH", "1YSW", "2O21", "2O22", "2O2F", "2W3L", "2XA0" ], "grounding": [ { "paper": "Overexpression of Bcl-2 Protects from Ultraviolet B-Induced Apoptosis but Promotes Hair Follicle Regression and Chemotherapy-Induced Alopecia", "quote": "Overexpression of Bcl-2 Protects from Ultraviolet B- Induced Apoptosis but Promotes Hair Follicle Regression and Chemotherapy-Induced Alopecia Sven Mu¨ller-Ro¨ver,*† Heidemarie Rossiter,* Ralf Paus,‡ Bor", "n_hits": 276 }, { "paper": "Polyphenols from Bacopa procumbens Nanostructured with Gold Nanoparticles Stimulate Hair Growth Through Apoptosis Modulation in C57BL 6 Mice", "quote": "in BFNB were analyzed in silico. In vivo experiments evaluated the expression of pro-apoptotic markers p53, caspase 3-p11, caspase 9-p10, and Bax, as well as anti-apoptotic marker Bcl-2, through Western blotting. Immunohistochemistry further assessed the expression and localization of some of these ", "n_hits": 72 }, { "paper": "Connarus semidecandrus Jack Exerts Anti-Alopecia Effects by Targeting 5α-Reductase Activity and an Intrinsic Apoptotic Pathway", "quote": "to the anagen phase. Western blotting indicated that Cs-EE reduced the expression of the androgenic receptor. Cs-EE treatment also inhibited programmed cell death by upregulating Bcl-2 expression at the mRNA and protein levels. The anti-alopecia effect of Cs-EE was confirmed by in vitro experiments s", "n_hits": 50 }, { "paper": "Caizhixuan hair tonic regulates both apoptosis and the PI3K Akt pathway to treat androgenetic alopecia", "quote": "- work pharmacology, CZX alleviated AGA by regulating PI3K/Akt and apoptosis pathways. According to RT-qPCR and Western blotting, CZX upregulated the expressions of PI3K, Akt, and Bcl-2, while downregulating that of Bax and caspase-3. PLOS ONE PLOS ONE | https://doi.org/10.1371/journal.pone.0282427 ", "n_hits": 26 } ], "grounded_in_corpus": true }, { "gene": "IFNG", "name": "Interferon gamma", "diseases": [ "AA" ], "pathway": "JAK-STAT", "twin_node": "INF", "effect": "+", "role": "driver", "drugs": [ "IFN-gamma pathway blocked indirectly by JAK inhibitors", "anti-IFNγ" ], "mechanism": "NKG2D+ CD8 T 분비; 모낭 면역특권 붕괴 주범.", "evidence_paper_ids": [ "41557935", "41579939", "41723466", "41740930" ], "n_evidence": 4, "mention_count": 3, "sources": [ "discover:AA", "extract", "seed" ], "in_model": true, "uncertain": false, "structure": { "accession": "P01579", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/P01579", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-P01579-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-P01579-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/P01579", "mean_plddt": 85.3, "plddt_band": "Confident (70–90)", "n_residues": 166, "local_pdb": "digital_twin\\data\\structures\\P01579_AF.pdb" }, "uniprot": "P01579", "uniprot_name": "Interferon gamma", "length": 166, "function": "Type II interferon produced by immune cells such as T-cells and NK cells that plays crucial roles in antimicrobial, antiviral, and antitumor responses by activating effector immune cells and enhancing antigen presentation (PubMed:16914093, PubMed:8666937). Primarily signals through the JAK-STAT pathway after interaction with its receptor IFNGR1 to affect gene regulation (PubMed:8349687). Upon IFNG binding, IFNGR1 intracellular domain opens out to allow association of downstream signaling components JAK2, JAK1 and STAT1, leading to STAT1 activation, nuclear translocation and transcription of IF", "pdb_count": 7, "pdb_ids": [ "1EKU", "1FG9", "1FYH", "1HIG", "3BES", "6E3K", "6E3L" ], "grounding": [ { "paper": "Induction of alopecia areata in C3H HeJ mice using polyinosinic-polycytidylic acid (poly[IC]) and interferon-gamma", "quote": "8) 8:12518 | DOI:10.1038/s41598-018-30997-3 www.nature.com/scientificreports Induction of alopecia areata in C3H/HeJ mice using polyinosinic- polycytidylic acid (poly[I:C]) and interferon-gamma Jung-Min Shin1, Dae-Kyoung Choi2, Kyung-Cheol Sohn1, Jung-Woo Koh1, Young Ho Lee3, Young-Joon Seo1, Chang ", "n_hits": 90 }, { "paper": "SOCS3 treatment prevents the development of alopecia areata by inhibiting CD8+ T cell-mediated autoimmune destruction", "quote": ", China 2Department of Plastic Surgery, Shanghai International Medical Center, Shanghai, China Correspondence to: Wei Wu, email: babevivi@126.com Keywords: alopecia areata, SOCS3, IFN-γ, autoimmune, hair follicle Received: October 02, 2016 Accepted: February 23, 2017 Published: March 23, 2017 Copyri", "n_hits": 64 }, { "paper": "CXCR3 Blockade Inhibits T-cell Migration into the Skin and Prevents Development of Alopecia Areata", "quote": "New York, NY, 10032, USA Abstract Alopecia areata (AA) is an autoimmune disease of the hair follicle (HF) that results in hair loss of varying severity. Recently, we showed that IFN-γ-producing NKG2D+CD8+ T cells actively infiltrate the HF, and are responsible for its destruction in C3H/HeJ AA mice.", "n_hits": 45 }, { "paper": "Selective inhibition of JAK3 signaling is sufficient to reverse alopecia areata", "quote": "mulate in the skin and contribute to HF destruction (4, 5). The pathogenesis of AA is also associated with the overexpression of proinflammatory cytokines, such as interferon-γ (IFN-γ) and common γ chain (γc) cytokines, which break down HF immune privilege and promote the survival and function of cy", "n_hits": 39 } ], "grounded_in_corpus": true }, { "gene": "STAT3", "name": "Signal transducer STAT3", "diseases": [ "AA", "AGA" ], "pathway": "JAK-STAT", "twin_node": "INF", "effect": "+", "role": "modulator", "drugs": [], "mechanism": "염증·모낭 줄기세포 양면 작용.", "evidence_paper_ids": [ "41604837", "41723466", "PPR1134993" ], "n_evidence": 3, "mention_count": 3, "sources": [ "discover:AA", "extract", "seed" ], "in_model": true, "uncertain": false, "structure": { "accession": "P40763", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/P40763", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-P40763-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-P40763-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/P40763", "mean_plddt": 84.9, "plddt_band": "Confident (70–90)", "n_residues": 770, "local_pdb": "digital_twin\\data\\structures\\P40763_AF.pdb" }, "uniprot": "P40763", "uniprot_name": "Signal transducer and activator of transcription 3", "length": 770, "function": "Signal transducer and transcription activator that mediates cellular responses to interleukins, KITLG/SCF, LEP and other growth factors (PubMed:10688651, PubMed:12359225, PubMed:12873986, PubMed:15194700, PubMed:15653507, PubMed:16285960, PubMed:17344214, PubMed:18242580, PubMed:18782771, PubMed:22306293, PubMed:23084476, PubMed:28262505, PubMed:32929201, PubMed:38404237). Once activated, recruits coactivators, such as NCOA1 or MED1, to the promoter region of the target gene (PubMed:15653507, PubMed:16285960, PubMed:17344214, PubMed:18782771, PubMed:28262505, PubMed:32929201). May mediate cell", "pdb_count": 6, "pdb_ids": [ "5AX3", "5U5S", "6NJS", "6NUQ", "6QHD", "6TLC" ], "grounding": [ { "paper": "Reversal of alopecia areata, osteoporosis follow treatment with activation of Tgr5 in mice", "quote": "he appearance of alopecia areata and bone microstructure has improved. Immunohistochemistry and qPCR analysis showed that activation of Tgr5 can down-regulate the express of JAK1, STAT3, IL-6, TNF-α, and VEGF. Conclusion: These findings indicate that activation of Tgr5 mediated amelioration of alope", "n_hits": 20 }, { "paper": "CXCL12 Neutralizing Antibody Promotes Hair Growth in Androgenic Alopecia and Alopecia Areata", "quote": "f AA and reduced the number of CD8+ cells. Interferon-γ (IFNγ) treatment increased the secretion of CXCL12 from DFs through the signal transducer and activator of transcription 3 (STAT3) pathway, and αCXCL12 treatment protected the hair follicle from IFNγ in hair organ culture. Collectively, these r", "n_hits": 16 }, { "paper": "Involvement of DKK1 secreted from adipose‐derived stem cells in alopecia areata", "quote": "alopecia areata (AA), a condition characterised by significant increases in the DKK1 levels in human and mouse ASCs. Treatment of interferon-γ increased the expression of DKK1 via STAT3 phosphoryla- tion in ASCs. Treatment with recombinant DKK1 resulted in a decrease of cell growth in outer root she", "n_hits": 15 }, { "paper": "Modulating immune responses in alopecia therapeutic insights and potential targets of antisense oligonucleotides", "quote": "hibition promotes the production of Th1 cytokines and chemokines, impairing inflammation, while SIRT1 activation suppresses autoreactive responses through NF-κB deacetylation and STAT3 phosphorylation. Additionally, antisense oligonucleotides (ASOs) targeting miR-485-3p show therapeutic potential in", "n_hits": 13 } ], "grounded_in_corpus": true }, { "gene": "TP53", "name": "Cellular tumor antigen p53", "diseases": [ "AGA", "CIA" ], "pathway": "Cell-cycle/apoptosis", "twin_node": "APO", "effect": "+", "role": "driver", "drugs": [ "ALRN-6924 (stapled peptide, clinical)", "Cyclophosphamide (inducer, not therapeutic)", "Pifithrin-alpha (experimental)", "Pifithrin-alpha (p53 inhibitor, experimental)", "p53 inhibitor(temporary)" ], "mechanism": "화학요법 DNA 손상→모기질 apoptosis 핵심 매개.", "evidence_paper_ids": [ "39638216", "41506142", "41615374" ], "n_evidence": 3, "mention_count": 3, "sources": [ "discover:CIA", "discover:HFSC", "discover:recent", "extract", "seed" ], "in_model": true, "uncertain": false, "structure": { "accession": "P04637", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/P04637", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-P04637-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-P04637-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/P04637", "mean_plddt": 75.1, "plddt_band": "Confident (70–90)", "n_residues": 393, "local_pdb": "digital_twin\\data\\structures\\P04637_AF.pdb" }, "uniprot": "P04637", "uniprot_name": "Cellular tumor antigen p53", "length": 393, "function": "Multifunctional transcription factor that induces cell cycle arrest, DNA repair or apoptosis upon binding to its target DNA sequence (PubMed:11025664, PubMed:12524540, PubMed:12810724, PubMed:15186775, PubMed:15340061, PubMed:17317671, PubMed:17349958, PubMed:19556538, PubMed:20673990, PubMed:20959462, PubMed:22726440, PubMed:24051492, PubMed:24652652, PubMed:35618207, PubMed:36634798, PubMed:38653238, PubMed:9840937). Acts as a tumor suppressor in many tumor types; induces growth arrest or apoptosis depending on the physiological circumstances and cell type (PubMed:11025664, PubMed:12524540, ", "pdb_count": 286, "pdb_ids": [ "1A1U", "1AIE", "1C26", "1DT7", "1GZH", "1H26", "1HS5", "1JSP" ], "grounding": [ { "paper": "Polyphenols from Bacopa procumbens Nanostructured with Gold Nanoparticles Stimulate Hair Growth Through Apoptosis Modulation in C57BL 6 Mice", "quote": "biological activities of the secondary metabolites of B. procumbens present in BFNB were analyzed in silico. In vivo experiments evaluated the expression of pro-apoptotic markers p53, caspase 3-p11, caspase 9-p10, and Bax, as well as anti-apoptotic marker Bcl-2, through Western blotting. Immunohisto", "n_hits": 87 }, { "paper": "Role for the Epidermal Growth Factor Receptor in Chemotherapy-Induced Alopecia", "quote": "decreased follicular proliferation, but did not progress to telogen as did Egfr wild type follicles. Egfr mutant follicles responded with less proliferation, apoptosis, and fewer p53-positive cells after cyclophosphamide. Treatment of control mice with the EGFR inhibitors erlotinib or gefitinib simi", "n_hits": 40 }, { "paper": "Effect of N-acetylcysteine on hair follicle changes in mouse model of cyclophosphamide-induced alopecia histological and biochemical study", "quote": "uced an increase in malondialdehyde (MDA), decrease in superoxide dismutase (SOD), histological hair follicle dystrophy, disruption of follicular melanogenesis, overexpression of p53, and loss of ki67 immunoreactivity. NAC coadmin- istration in group III reversed CYP-induced alterations in the bioch", "n_hits": 31 }, { "paper": "ISEV2025 Abstract Book.", "quote": "edicine, we also identified a further need for testing to ultimately decide if ASC-EVs really are the Jack of all trades or masters of none. PS1.9 Exploring the biodistribution of p53-containing EVs for targeted cancer therapy Ishai Luz1, Gil Shalev2, Doaa Massad1, Tomer Cooks1, Alexander Tendler2 1", "n_hits": 30 } ], "grounded_in_corpus": true }, { "gene": "AKT1", "name": "RAC-alpha serine/threonine kinase (AKT1)", "diseases": [ "AA", "AGA", "CIA" ], "pathway": "PI3K-AKT-mTOR", "twin_node": "DP", "effect": "+", "role": "protector", "drugs": [ "minoxidil (activates AKT)" ], "mechanism": "DP 세포 생존·증식; anagen 유지.", "evidence_paper_ids": [ "39922517", "41561359" ], "n_evidence": 2, "mention_count": 2, "sources": [ "discover:AGA", "extract", "seed" ], "in_model": true, "uncertain": false, "structure": { "accession": "P31749", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/P31749", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-P31749-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-P31749-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/P31749", "mean_plddt": 83.0, "plddt_band": "Confident (70–90)", "n_residues": 480, "local_pdb": "digital_twin\\data\\structures\\P31749_AF.pdb" }, "uniprot": "P31749", "uniprot_name": "RAC-alpha serine/threonine-protein kinase", "length": 480, "function": "AKT1 is one of 3 closely related serine/threonine-protein kinases (AKT1, AKT2 and AKT3) called the AKT kinase, and which regulate many processes including metabolism, proliferation, cell survival, growth and angiogenesis (PubMed:11882383, PubMed:15526160, PubMed:15861136, PubMed:21432781, PubMed:21620960, PubMed:31204173). This is mediated through serine and/or threonine phosphorylation of a range of downstream substrates (PubMed:11882383, PubMed:15526160, PubMed:21432781, PubMed:21620960, PubMed:29343641, PubMed:31204173). Over 100 substrate candidates have been reported so far, but for most ", "pdb_count": 42, "pdb_ids": [ "1H10", "1UNP", "1UNQ", "1UNR", "2UVM", "2UZR", "2UZS", "3CQU" ], "grounding": [ { "paper": "Pilose antler extracts promotes hair growth in androgenetic alopecia mice by activating hair follicle stem cells via the AKT and Wnt pathways", "quote": "Pilose antler extracts promotes hair growth in androgenetic alopecia mice by activating hair follicle stem cells via the AKT and Wnt pathways Fenglong Wang 1†, Gaiying He2†, Menghua Liu1, Yanan Sun 2, Shuhua Ma2, Zhenxiao Sun1* and Yi Wang2* 1School of Life Sciences, Beijing University of Chinese Me", "n_hits": 70 }, { "paper": "Effects of Baicalin on Alopecia and the Associated Mechanism", "quote": "ation of cell-cell adhesion, vesicle lumen, cytoplasmic vesicle, membrane raft, and endopeptidase activity. Multiple pathways were identified, such as proteoglycans in cancer, PI3K/AKT, and forkhead box O signaling pathways. Following baicalin treatment for the experimental mice, the coverage, length", "n_hits": 49 }, { "paper": "Therapeutic potential of isoproterenol in androgenetic alopecia activation of hair follicle stem cells via the PI3K AKT β-Catenin signaling pathway", "quote": "owth in animal models via the Sonic Hedgehog (SHH) pathway, but its potential for treating clinical AGA patients remains unexamined. Methods We investigated the role of the PI3K/AKT signaling pathway in AGA pathogenesis, focusing on the hair follicle-sympathetic nerve axis. The ADRB2 agonist, isopro", "n_hits": 45 }, { "paper": "Caizhixuan hair tonic regulates both apoptosis and the PI3K Akt pathway to treat androgenetic alopecia", "quote": "RESEARCH ARTICLE Caizhixuan hair tonic regulates both apoptosis and the PI3K/Akt pathway to treat androgenetic alopecia Tingting FangID1, Ruofei Xu2, Shaopeng Sun1, Yineng He1, Yi Yan1, Hongyang Fu3, Hongbin Luo3, Yi Cao3, Maocan TaoID3* 1 The First Clinical M", "n_hits": 36 } ], "grounded_in_corpus": true }, { "gene": "CD34", "name": "Hematopoietic progenitor cell antigen CD34", "diseases": [ "AGA", "CIA" ], "pathway": "HFSC niche", "twin_node": "HFSC", "effect": "+", "role": "protector", "drugs": [], "mechanism": "모낭 bulge/벌지 줄기세포 마커.", "evidence_paper_ids": [ "40672523", "41629248" ], "n_evidence": 2, "mention_count": 2, "sources": [ "discover:HFSC", "extract", "seed" ], "in_model": true, "uncertain": false, "structure": { "accession": "P28906", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/P28906", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-P28906-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-P28906-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/P28906", "mean_plddt": 60.4, "plddt_band": "Low (50–70)", "n_residues": 385, "local_pdb": "digital_twin\\data\\structures\\P28906_AF.pdb" }, "uniprot": "P28906", "uniprot_name": "Hematopoietic progenitor cell antigen CD34", "length": 385, "function": "Possible adhesion molecule with a role in early hematopoiesis by mediating the attachment of stem cells to the bone marrow extracellular matrix or directly to stromal cells. Could act as a scaffold for the attachment of lineage specific glycans, allowing stem cells to bind to lectins expressed by stromal cells or other marrow components. Presents carbohydrate ligands to selectins", "pdb_count": 0, "pdb_ids": [], "grounding": [ { "paper": "JAK-STAT1 as therapeutic target for EGFR deficiency-associated inflammation and scarring alopecia", "quote": "SOS expression and antibiotic therapy (Abx) prevented visible hair loss between 2 and 5 months of age in EGFRΔep mice (Fig. 1A). Additional FACS analysis revealed the loss of the CD34 positive hair follicle stem cell (HFSC) niche preceding macroscopic hair loss (Figs. 1A,B and EV1A for overall FACS ", "n_hits": 55 }, { "paper": "Secretory phospholipase A2-IIA overexpressing mice exhibit cyclic alopecia mediated through aberrant hair shaft differentiation and impaired wound healing response", "quote": "ferentiation. Therefore, we attempted to understand the profile of hair follicle stem cells. We performed FACS analysis by using the mouse hair follicle stem cell markers such as CD34 and α6 integrin. Our results showed drastic depletion of CD34+/α6 integrin+ hair follicle stem cells at PD28 (Fig. 3", "n_hits": 12 }, { "paper": "Ox40-Cre–mediated deletion of BRD4 reveals an unexpected phenotype of hair follicle stem cells in alopecia", "quote": "confined to the skin. Surprisingly, we found substantial Ox40-Cre activities and consequently YFP expression in the skin (Figure 2C). In fact, YFP was expressed at high levels in CD34+ follicle stem cells, as well as in cell types derived from such stem cells, which include the epidermal cells, hair", "n_hits": 9 }, { "paper": "ISEV2025 Abstract Book.", "quote": "e analysed by flow cytometry. Cardiac function was evaluated via echocardiography before and after sepsis induction. Results: ECFCs exhibited endothelial progenitor markers (CD31, CD34, VCAM), and ECFC-EVs expressed both CD31 and the vesicular marker CD63. In vitro exposure to LPS significantly upre", "n_hits": 8 } ], "grounded_in_corpus": true }, { "gene": "DKK1", "name": "Dickkopf-related protein 1", "diseases": [ "AA", "AGA" ], "pathway": "Wnt/β-catenin", "twin_node": "Wnt", "effect": "-", "role": "driver", "drugs": [ "anti-DKK1", "anti-DKK1 / DKK1 inhibitors (investigational)", "anti-DKK1 antibodies (preclinical)" ], "mechanism": "Wnt 억제자. AGA 는 DHT 유도, AA 는 IFN-γ→STAT3 유도(ADSC 분비) — 코퍼스 논문 'Involvement of DKK1...in alopecia areata'로 AA 근거 확인.", "evidence_paper_ids": [ "41571202", "41751951" ], "n_evidence": 2, "mention_count": 2, "sources": [ "discover:AGA", "discover:recent", "extract", "seed" ], "in_model": true, "uncertain": false, "structure": { "accession": "O94907", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/O94907", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-O94907-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-O94907-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/O94907", "mean_plddt": 70.0, "plddt_band": "Low (50–70)", "n_residues": 266, "local_pdb": "digital_twin\\data\\structures\\O94907_AF.pdb" }, "uniprot": "O94907", "uniprot_name": "Dickkopf-related protein 1", "length": 266, "function": "Antagonizes canonical Wnt signaling by inhibiting LRP5/6 interaction with Wnt and by forming a ternary complex with the transmembrane protein KREMEN that promotes internalization of LRP5/6 (PubMed:22000856). DKKs play an important role in vertebrate development, where they locally inhibit Wnt regulated processes such as antero-posterior axial patterning, limb development, somitogenesis and eye formation. In the adult, Dkks are implicated in bone formation and bone disease, cancer and Alzheimer disease (PubMed:17143291). Inhibits the pro-apoptotic function of KREMEN1 in a Wnt-independent manner", "pdb_count": 5, "pdb_ids": [ "3S2K", "3S8V", "3SOQ", "5FWW", "5GJE" ], "grounding": [ { "paper": "Involvement of DKK1 secreted from adipose‐derived stem cells in alopecia areata", "quote": "O R I G I N A L A R T I C L E Involvement of DKK1 secreted from adipose-derived stem cells in alopecia areata Nahyun Choi1 | Juyeong Hwang1 | Doo Yeong Kim2 | Jino Kim3 | Seung Yong Song4 | Jong-Hyuk Sung1,2 1Epi Biotech Co., Ltd", "n_hits": 220 }, { "paper": "Oxyresveratrol enhances hair regeneration in human dermal papilla cell and androgenetic alopecia mouse model", "quote": "n, yielding a proliferation rate of 116.97 ± 8.58% compared to the control (P < 0.05; Fig. 1a). To elucidate the biological impact of ORV on HFDPC, the mRNA expression levels of DKK1 and β-catenin were analyzed using RT-PCR. Treatment with ORV at concentrations of 5 µg/ml and 10 µg/ml resulted in a ", "n_hits": 17 }, { "paper": "Stauntonia hexaphylla Extract Ameliorates Androgenic Alopecia by Inhibiting Androgen Signaling in Testosterone-induced Alopecia Mice", "quote": "R) levels, apoptosis, and cell prolifer- ation in vitro and in vivo. In addition, paracrine factors for androgenic alopecia, such as transforming growth factor beta-1 (TGF-β1) and dickkopf-a (DKK-1), were examined. Apoptosis was investigated, and the evaluation of proliferation was examined with cyt", "n_hits": 17 }, { "paper": "Black phosphorus nanosheets encapsulated microneedle for multifunctional therapy for androgenic alopecia", "quote": "nced cellular uptake, and effectively modulated gene expression in dihydrotestosterone-treated human dermal papilla cells, downregulating negative regulators such as SRD5A2, AR, DKK1, and TGFB1, while upregulating positive regulators like CTNNBIP1 and VEGFA. Furthermore, we encapsulated BP-BA to MN ", "n_hits": 15 } ], "grounded_in_corpus": true }, { "gene": "FOXP3", "name": "Forkhead box protein P3", "diseases": [ "AA" ], "pathway": "Immune tolerance", "twin_node": "INF", "effect": "-", "role": "protector", "drugs": [ "IL-2/Treg", "low-dose IL-2 (Treg-restoring, investigational)" ], "mechanism": "조절 T세포 마스터 인자; 결핍 시 자가면역.", "evidence_paper_ids": [ "41579939", "41740930" ], "n_evidence": 2, "mention_count": 2, "sources": [ "discover:AA", "extract", "seed" ], "in_model": true, "uncertain": false, "structure": { "accession": "Q9BZS1", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/Q9BZS1", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-Q9BZS1-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-Q9BZS1-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/Q9BZS1", "mean_plddt": 56.7, "plddt_band": "Low (50–70)", "n_residues": 431, "local_pdb": "digital_twin\\data\\structures\\Q9BZS1_AF.pdb" }, "uniprot": "Q9BZS1", "uniprot_name": "Forkhead box protein P3", "length": 431, "function": "Transcriptional regulator which is crucial for the development and inhibitory function of regulatory T-cells (Treg) (PubMed:17377532, PubMed:21458306, PubMed:23947341, PubMed:24354325, PubMed:24722479, PubMed:24835996, PubMed:30513302, PubMed:32644293). Plays an essential role in maintaining homeostasis of the immune system by allowing the acquisition of full suppressive function and stability of the Treg lineage, and by directly modulating the expansion and function of conventional T-cells (PubMed:23169781). Can act either as a transcriptional repressor or a transcriptional activator dependin", "pdb_count": 2, "pdb_ids": [ "3QRF", "4WK8" ], "grounding": [ { "paper": "Blockade of IL-7 signaling suppresses inflammatory responses and reverses alopecia areata in C3H HeJ mice", "quote": "s. pSTAT5 MFI (2 × 10 ) ** * IL-7/GAPDH(×10–4) C3H NC C3H AA 0 2 4 6 G I 2 0 2 4 6 8 10 pSTAT5 MFI (2 × 10 ) 0 2 4 6 8 10 2 Isotype AA skin NC skin NC SDLN AA SDLN Isotype Foxp3– Foxp3+ B NC AA NC AA IL-7Rα CD8 CD4 H K 47.6 26.4 7.17 18.8 49.7 26.9 4.16 19.3 38.8 42.4 3.28 15.5 39.8 41.0 2.91 16.3 5", "n_hits": 55 }, { "paper": "Ox40-Cre–mediated deletion of BRD4 reveals an unexpected phenotype of hair follicle stem cells in alopecia", "quote": "stimulatory molecule in the TNF receptor superfamily primarily involved in Treg prolif­ eration, survival, and memory generation (3, 4). In naive mice, OX40 is mainly expressed by Foxp3+ Tregs (5). However, upon immune activation, activated T effector cells also express OX40, and upon binding its li", "n_hits": 55 }, { "paper": "Immunoregulatory Effects of Myeloid-Derived Suppressor Cell Exosomes in Mouse Model of Autoimmune Alopecia Areata", "quote": "ented progression and sufficed for partial hair regrowth. Deep sequencing of lymphocyte mRNA from these mice revealed a significant increase in immunoregula­ tory mRNA, including FoxP3 and arginase 1. Downregulated mRNA was preferentially engaged in prohibiting T cell hyperreactivity. Taken together", "n_hits": 32 }, { "paper": "Selective Expansion of Tregs Using the IL-2 Cytokine Antibody Complex Does Not Reverse Established Alopecia Areata in C3H HeJ Mice", "quote": "se overnight before embedding in OCT. Tissue sections were stained primarily with anti-CD3-BV480 (1:1,000, 17A2), anti-CD4-AF488 (1:250, RM4-5), anti-CD8a-PE (1:250, 53-6.7), anti-FoxP3-APC (1:250, FJK-16s), and anti-GL3-biotin (1:250, GL3), followed by secondary SA-AF750 (1:10,000) at RT. Slides we", "n_hits": 24 } ], "grounded_in_corpus": true }, { "gene": "IL15", "name": "Interleukin-15", "diseases": [ "AA" ], "pathway": "JAK-STAT", "twin_node": "INF", "effect": "+", "role": "driver", "drugs": [ "anti-IL-15 / anti-IL-15Rbeta (investigational)", "anti-IL-15Rbeta antibodies (preclinical/early clinical)", "anti-IL15" ], "mechanism": "모낭 상피→CD8 T 'danger' 신호; AA 의 핵심 사이토카인 루프.", "evidence_paper_ids": [ "41557935", "41740930" ], "n_evidence": 2, "mention_count": 2, "sources": [ "discover:AA", "discover:recent", "extract", "seed" ], "in_model": true, "uncertain": false, "structure": { "accession": "P40933", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/P40933", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-P40933-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-P40933-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/P40933", "mean_plddt": 84.7, "plddt_band": "Confident (70–90)", "n_residues": 162, "local_pdb": "digital_twin\\data\\structures\\P40933_AF.pdb" }, "uniprot": "P40933", "uniprot_name": "Interleukin-15", "length": 162, "function": "Cytokine that plays a major role in the development of inflammatory and protective immune responses to microbial invaders and parasites by modulating immune cells of both the innate and adaptive immune systems (PubMed:15123770). Stimulates the proliferation of natural killer cells, T-cells and B-cells and promotes the secretion of several cytokines (PubMed:8178155, PubMed:9326248). In monocytes, induces the production of IL8 and monocyte chemotactic protein 1/CCL2, two chemokines that attract neutrophils and monocytes respectively to sites of infection (PubMed:9326248). Unlike most cytokines, ", "pdb_count": 4, "pdb_ids": [ "2XQB", "2Z3Q", "2Z3R", "4GS7" ], "grounding": [ { "paper": "Induction of T cell exhaustion by JAK1 3 inhibition in the treatment of alopecia areata", "quote": "hogenesis of AA is also associated with the overexpression of cytokines, including interferon gamma (IFN-g) and the common gamma chain (gc) cytokines interleukin (IL)-2, IL-7, and IL-15, which promote the activity of alopecic T lymphocytes in affected skin (3, 4, 7). The IFN-g and gc cytokines signa", "n_hits": 12 }, { "paper": "Selective inhibition of JAK3 signaling is sufficient to reverse alopecia areata", "quote": "JAK3i) with various cytokines (Supplemental Table 1; supplemental material available online with this article; https://doi.org/10.1172/jci.insight.142205DS1). We tested IL-7 and IL-15, which signal through JAK1/3 and lead to STAT5 tyrosine phosphorylation, and found that INCB039110 and PF-06651600 (", "n_hits": 10 }, { "paper": "Mesenchymal Stem Cell Therapy in Alopecia Areata Visual and Molecular Evidence from a Mouse Model", "quote": "nduction of AA and also did not receive any treatment. We examined the mRNA expression of immune-related cytokines, including JAK1, JAK2, STAT1, STAT3, IFN-γR, IL-1β, IL-6, IL-10, IL-15, IL-17α, IL-18, and IL-22 (Figure 4). In the AA-induced CTL mice, JAK1, JAK2, STAT1, STAT3, IFN-γR, IL-1β, IL-10, ", "n_hits": 8 }, { "paper": "Blockade of IL-7 signaling suppresses inflammatory responses and reverses alopecia areata in C3H HeJ mice", "quote": "gation of the cyto- kines that drive their activation and function (5, 6). Our transcrip- tional profiling analysis revealed that the c cytokines interleukin-2 (IL-2), IL-7, and IL-15 were up-regulated in lesional skin from both humans and C3H/HeJ mice with AA (6). Blockade of either of IL-2 or IL-", "n_hits": 6 } ], "grounded_in_corpus": true }, { "gene": "JAK1", "name": "Tyrosine-protein kinase JAK1", "diseases": [ "AA", "CIA" ], "pathway": "JAK-STAT", "twin_node": "INF", "effect": "+", "role": "driver", "drugs": [ "INCB054707", "abrocitinib", "baricitinib", "ruxolitinib", "tofacitinib", "upadacitinib" ], "mechanism": "IFNγ/IL-15 신호 전달; AA 면역특권 붕괴 매개.", "evidence_paper_ids": [ "41263532", "41353672", "41508895", "41517644", "41557935", "41656280", "41733801", "41779764", "41780025" ], "n_evidence": 9, "mention_count": 2, "sources": [ "discover:AA", "extract", "seed" ], "in_model": true, "uncertain": true, "structure": { "accession": "P23458", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/P23458", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-P23458-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-P23458-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/P23458", "mean_plddt": 85.6, "plddt_band": "Confident (70–90)", "n_residues": 1154, "local_pdb": "digital_twin\\data\\structures\\P23458_AF.pdb" }, "uniprot": "P23458", "uniprot_name": "Tyrosine-protein kinase JAK1", "length": 1154, "function": "Tyrosine kinase of the non-receptor type, involved in the IFN-alpha/beta/gamma signal pathway (PubMed:16239216, PubMed:28111307, PubMed:32750333, PubMed:7615558, PubMed:8232552). Kinase partner for the interleukin (IL)-2 receptor (PubMed:11909529) as well as interleukin (IL)-10 receptor (PubMed:12133952). Kinase partner for the type I interferon receptor IFNAR2 (PubMed:16239216, PubMed:28111307, PubMed:32750333, PubMed:7615558, PubMed:8232552). In response to interferon-binding to IFNAR1-IFNAR2 heterodimer, phosphorylates and activates its binding partner IFNAR2, creating docking sites for STA", "pdb_count": 51, "pdb_ids": [ "3EYG", "3EYH", "4E4L", "4E4N", "4E5W", "4EHZ", "4EI4", "4FK6" ], "grounding": [ { "paper": "Selective Janus kinase 1 inhibition resolves inflammation and restores hair growth offering a viable treatment option for alopecia areata", "quote": "at ranges close to a questionable risk profile. Objectives: We explored the possibility to separate the beneficial and adverse effects of JAK inhibition by selectively inhibiting JAK1 and thereby avoiding side effects associated with JAK2 blockade. Methods: The C3H/HeJ mouse model of AA was used to ", "n_hits": 112 }, { "paper": "Selective inhibition of JAK3 signaling is sufficient to reverse alopecia areata", "quote": "(10–12). AA is characterized by dysregulation of JAK/STAT activity, in particular, the γc cytokine and IFN-γ signaling pathway (3, 4). Our lab recently pioneered the use of the JAK1/2 inhibitor ruxolitinib and baricitinib, as well as the pan-JAK inhibitor, tofacitinib, in the treatment of human AA (", "n_hits": 62 }, { "paper": "Induction of T cell exhaustion by JAK1 3 inhibition in the treatment of alopecia areata", "quote": "Induction of T cell exhaustion by JAK1/3 inhibition in the treatment of alopecia areata Zhenpeng Dai 1, Tanya Sezin 1, Yuqian Chang 1, Eunice Y. Lee 1, Eddy Hsi Chun Wang 1 and Angela M. Christiano 1,2* 1Department of", "n_hits": 47 }, { "paper": "JAK-STAT1 as therapeutic target for EGFR deficiency-associated inflammation and scarring alopecia", "quote": "synergistically with interferon gamma expressing CD8 T-cell and NK-cell-mediated inflammation, com- promised the stem cell niche. Hair follicle-specific genetic depletion of either JAK1/2 or STAT1 or therapeutic inhibition of JAK1/2 ameliorated the inflammation, restored skin barrier function and activ", "n_hits": 39 } ], "grounded_in_corpus": true }, { "gene": "JAK2", "name": "Tyrosine-protein kinase JAK2", "diseases": [ "AA" ], "pathway": "JAK-STAT", "twin_node": "INF", "effect": "+", "role": "driver", "drugs": [ "baricitinib", "ruxolitinib", "tofacitinib" ], "mechanism": "baricitinib(JAK1/2) FDA 승인 AA 치료 표적.", "evidence_paper_ids": [ "41604837", "41733801", "41740930", "41779764", "41780025" ], "n_evidence": 5, "mention_count": 2, "sources": [ "discover:AA", "extract", "seed" ], "in_model": true, "uncertain": false, "structure": { "accession": "O60674", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/O60674", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-O60674-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-O60674-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/O60674", "mean_plddt": 86.9, "plddt_band": "Confident (70–90)", "n_residues": 1132, "local_pdb": "digital_twin\\data\\structures\\O60674_AF.pdb" }, "uniprot": "O60674", "uniprot_name": "Tyrosine-protein kinase JAK2", "length": 1132, "function": "Non-receptor tyrosine kinase involved in various processes such as cell growth, development, differentiation or histone modifications. Mediates essential signaling events in both innate and adaptive immunity. In the cytoplasm, plays a pivotal role in signal transduction via its association with type I receptors such as growth hormone (GHR), prolactin (PRLR), leptin (LEPR), erythropoietin (EPOR), thrombopoietin receptor (MPL/TPOR); or type II receptors including IFN-alpha, IFN-beta, IFN-gamma and multiple interleukins (PubMed:15690087, PubMed:7615558, PubMed:9657743, PubMed:15899890). Following", "pdb_count": 162, "pdb_ids": [ "2B7A", "2W1I", "2XA4", "3E62", "3E63", "3E64", "3FUP", "3IO7" ], "grounding": [ { "paper": "Selective inhibition of JAK3 signaling is sufficient to reverse alopecia areata", "quote": "JAK1/2 inhibitor ruxolitinib and baricitinib, as well as the pan-JAK inhibitor, tofacitinib, in the treatment of human AA (3, 13–15). However, the relative contribution of JAK1, JAK2, and JAK3 inhibition to the therapeutic benefit of ruxolitinib, baricitinib, and tofacitinib in AA has not been inves", "n_hits": 33 }, { "paper": "Selective Janus kinase 1 inhibition resolves inflammation and restores hair growth offering a viable treatment option for alopecia areata", "quote": "ives: We explored the possibility to separate the beneficial and adverse effects of JAK inhibition by selectively inhibiting JAK1 and thereby avoiding side effects associated with JAK2 blockade. Methods: The C3H/HeJ mouse model of AA was used to demonstrate therapeutic efficacy in vivo with differen", "n_hits": 14 }, { "paper": "Mesenchymal Stem Cell Therapy in Alopecia Areata Visual and Molecular Evidence from a Mouse Model", "quote": "visually and through tissue analysis. The MSC-treated group showed more hair regrowth compared to the control (CTL) group. MSCT notably reduced local inflammatory cytokines (JAK1, JAK2, STAT1, STAT3, IFN-γR, IL-1β, IL-16, IL-17α, and IL-18) in AA-induced mice’s skin, but systemic cytokine levels rem", "n_hits": 10 }, { "paper": "JAK-STAT1 as therapeutic target for EGFR deficiency-associated inflammation and scarring alopecia", "quote": "igen presentation WT Psmb10 Psmb8 Psmb9 Rpn1 Rpn2 Hspd1 Hspe1 Immunoproteasome -1 0 1 Osmr Il10rb Il11ra1 Il11ra2 Il13ra1 Il20rb Il4ra Il6ra Il6st Ifngr1 Ifngr2 Ifnar1 Ifnar2 Jak1 Jak2 Jak3 Tyk2 Stat1 Stat3 Stat4 Stat5a Stat5b Ifi214 Ifi47 Ifitm3 Socs3 JAK-STAT Pathway 0 20 40 60 80 ** **** ** **** ", "n_hits": 9 } ], "grounded_in_corpus": true }, { "gene": "JAK3", "name": "Tyrosine-protein kinase JAK3", "diseases": [ "AA" ], "pathway": "JAK-STAT", "twin_node": "INF", "effect": "+", "role": "driver", "drugs": [ "ritlecitinib", "tofacitinib" ], "mechanism": "γc 사이토카인 신호; ritlecitinib(JAK3/TEC) 승인 표적.", "evidence_paper_ids": [ "41449716", "41645877", "41740930", "41779764", "41780025" ], "n_evidence": 5, "mention_count": 2, "sources": [ "discover:AA", "extract", "seed" ], "in_model": true, "uncertain": false, "structure": { "accession": "P52333", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/P52333", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-P52333-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-P52333-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/P52333", "mean_plddt": 85.7, "plddt_band": "Confident (70–90)", "n_residues": 1124, "local_pdb": "digital_twin\\data\\structures\\P52333_AF.pdb" }, "uniprot": "P52333", "uniprot_name": "Tyrosine-protein kinase JAK3", "length": 1124, "function": "Non-receptor tyrosine kinase involved in various processes such as cell growth, development, or differentiation. Mediates essential signaling events in both innate and adaptive immunity and plays a crucial role in hematopoiesis during T-cells development. In the cytoplasm, plays a pivotal role in signal transduction via its association with type I receptors sharing the common subunit gamma such as IL2R, IL4R, IL7R, IL9R, IL15R and IL21R. Following ligand binding to cell surface receptors, phosphorylates specific tyrosine residues on the cytoplasmic tails of the receptor, creating docking sites", "pdb_count": 42, "pdb_ids": [ "1YVJ", "3LXK", "3LXL", "3PJC", "3ZC6", "3ZEP", "4HVD", "4HVG" ], "grounding": [ { "paper": "Selective inhibition of JAK3 signaling is sufficient to reverse alopecia areata", "quote": "Accepted: February 25, 2021 Published: April 8, 2021 Reference information: JCI Insight. 2021;6(7):e142205. https://doi.org/10.1172/jci. insight.142205. Selective inhibition of JAK3 signaling is sufficient to reverse alopecia areata Zhenpeng Dai,1 James Chen,1 Yuqian Chang,1 and Angela M. Christiano", "n_hits": 65 }, { "paper": "Induction of T cell exhaustion by JAK1 3 inhibition in the treatment of alopecia areata", "quote": "tly restored hair regrowth in the C3H/HeJ mouse model and in patients with AA (7, 12–14). Signaling through the six gc cytokines (IL-2, IL-4, IL-7, IL-9, IL-15 and IL-21) requires JAK3 binding to the gc present in the receptor complexes for all six cytokines, as well as JAK1 binding to the other cha", "n_hits": 17 }, { "paper": "Selective Janus kinase 1 inhibition resolves inflammation and restores hair growth offering a viable treatment option for alopecia areata", "quote": "ncreased risk of respiratory infections due to the immunosuppressive effects following long term use. The safety profile for Baricitinib (10 and 100‐fold selectivity over TYK2 and JAK3, respectively30) in AA was recently presented to be similar to that found in RA and AD31 (Press release https://inv", "n_hits": 12 }, { "paper": "Hydrogel forming microneedles loaded with VEGF and Ritlecitinib,polyhydroxyalkanoates nanoparticles for mini-invasive androgenetic alopecia treatment", "quote": "esis, Goldman demonstrated that VEGF expression was significantly reduced in alopecic follicles compared to normal human hair follicles [28,29]. Ritlecitinib is an inhibitor of JAK3 and TEC kinases, blocking γ common chain cytokine signaling and inhibiting CD8+ T cells and natural killer cells (thes", "n_hits": 5 } ], "grounded_in_corpus": true }, { "gene": "SHH", "name": "Sonic hedgehog protein", "diseases": [ "AGA", "CIA" ], "pathway": "Hedgehog", "twin_node": "SHH", "effect": "+", "role": "protector", "drugs": [ "SAG / hedgehog agonists (experimental)", "SAG agonist", "Vismodegib (antagonist; opposing context)" ], "mechanism": "모기질 증식·anagen 진행 핵심 형태형성소.", "evidence_paper_ids": [ "41263532", "41371370" ], "n_evidence": 2, "mention_count": 2, "sources": [ "discover:CIA", "extract", "seed" ], "in_model": true, "uncertain": false, "structure": { "accession": "Q15465", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/Q15465", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-Q15465-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-Q15465-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/Q15465", "mean_plddt": 78.4, "plddt_band": "Confident (70–90)", "n_residues": 462, "local_pdb": "digital_twin\\data\\structures\\Q15465_AF.pdb" }, "uniprot": "Q15465", "uniprot_name": "Sonic hedgehog protein", "length": 462, "function": "The C-terminal part of the sonic hedgehog protein precursor displays an autoproteolysis and a cholesterol transferase activity (By similarity). Both activities result in the cleavage of the full-length protein into two parts (ShhN and ShhC) followed by the covalent attachment of a cholesterol moiety to the C-terminal of the newly generated ShhN (By similarity). Both activities occur in the endoplasmic reticulum (By similarity). Once cleaved, ShhC is degraded in the endoplasmic reticulum (By similarity)", "pdb_count": 20, "pdb_ids": [ "3HO5", "3M1N", "3MXW", "6DMY", "6E1H", "6N7G", "6N7H", "6N7K" ], "grounding": [ { "paper": "Mice with a Targeted Mutation of Patched2 Are Viable but Develop Alopecia and Epidermal Hyperplasia†", "quote": "splicing appears to affect mostly the C-terminal region and the sterol- sensing domain (52). Biochemical studies revealed that human PTCH1 and PTCH2 bind to all Hh family members (Sonic hedgehog, Desert hedgehog [Dhh], and Indian hedgehog [Ihh]) with sim- ilar affinities (14). Since Ptc2 is highly ex", "n_hits": 60 }, { "paper": "Disrupted cholesterol biosynthesis and hair follicle stem cell impairment in the onset of alopecia", "quote": "sappearance of the hair follicles [14]. Hair follicle stem cell regeneration depends on a complex network orchestrated by multiple pathways, including the Wnt/β-catenin pathway, Sonic hedgehog (Shh) pathway, Notch pathway, BMP (bone morphogenetic proteins) pathway, and apoptotic pathway. Among these", "n_hits": 16 }, { "paper": "ISEV2025 Abstract Book.", "quote": "GA n◦ 101079264). PS2.952 PI3K/Rab signalling regionally and conditionally regulates large exosome biogenesis Shuo Wang, Yosuke Tanaka The University of Tokyo, Japan Introduction: Sonic hedgehog (SHH)-containing large exo- somes are a new type of large EVs. They may be equivalent to ‘ART-EVs’ that c", "n_hits": 13 }, { "paper": "Molecular signatures and signaling interactions of the hair follicle stem cell niche.", "quote": "Acad Sci U S A 2000;97(25):13824–9. [PubMed: 11087819] Sato N, Leopold PL, Crystal RG. Induction of the hair growth phase in postnatal mice by localized transient expression of Sonic hedgehog. J Clin Invest 1999;104(7):855–64. [PubMed: 10510326] Schneider MR, Schmidt-Ullrich R, Paus R. The hair foll", "n_hits": 12 } ], "grounded_in_corpus": true }, { "gene": "STAT1", "name": "Signal transducer STAT1", "diseases": [ "AA", "CIA" ], "pathway": "JAK-STAT", "twin_node": "INF", "effect": "+", "role": "driver", "drugs": [], "mechanism": "IFNγ 하류; 모낭 MHC-I 상향·CXCL10 유도.", "evidence_paper_ids": [ "41263532", "41740930" ], "n_evidence": 2, "mention_count": 2, "sources": [ "discover:AA", "extract", "seed" ], "in_model": true, "uncertain": false, "structure": { "accession": "P42224", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/P42224", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-P42224-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-P42224-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/P42224", "mean_plddt": 87.2, "plddt_band": "Confident (70–90)", "n_residues": 750, "local_pdb": "digital_twin\\data\\structures\\P42224_AF.pdb" }, "uniprot": "P42224", "uniprot_name": "Signal transducer and activator of transcription 1-alpha/beta", "length": 750, "function": "Signal transducer and transcription activator that mediates cellular responses to interferons (IFNs), cytokine KITLG/SCF and other cytokines and other growth factors (PubMed:12764129, PubMed:12855578, PubMed:15322115, PubMed:23940278, PubMed:34508746, PubMed:35568036, PubMed:9724754). Following type I IFN (IFN-alpha and IFN-beta) binding to cell surface receptors, signaling via protein kinases leads to activation of Jak kinases (TYK2 and JAK1) and to tyrosine phosphorylation of STAT1 and STAT2. The phosphorylated STATs dimerize and associate with ISGF3G/IRF-9 to form a complex termed ISGF3 tra", "pdb_count": 8, "pdb_ids": [ "1BF5", "1YVL", "2KA6", "3WWT", "7NUF", "8D3F", "8YYU", "8YYV" ], "grounding": [ { "paper": "JAK-STAT1 as therapeutic target for EGFR deficiency-associated inflammation and scarring alopecia", "quote": "Article JAK-STAT1 as therapeutic target for EGFR deficiency-associated inflammation and scarring alopecia Karoline Strobl1, Jörg Klufa1, Regina Jin 1, Lena Artner-Gent 1, Dana Krauß 1, Philipp Novosz", "n_hits": 88 }, { "paper": "Mesenchymal Stem Cell Therapy in Alopecia Areata Visual and Molecular Evidence from a Mouse Model", "quote": "ly and through tissue analysis. The MSC-treated group showed more hair regrowth compared to the control (CTL) group. MSCT notably reduced local inflammatory cytokines (JAK1, JAK2, STAT1, STAT3, IFN-γR, IL-1β, IL-16, IL-17α, and IL-18) in AA-induced mice’s skin, but systemic cytokine levels remained ", "n_hits": 10 }, { "paper": "Selective inhibition of JAK3 signaling is sufficient to reverse alopecia areata", "quote": "use macrophages, we observed that only CEP-33779 (but not INCB039110 or PF-06651600) inhibited JAK2-dependent GM-CSF signaling (Figure 1D). IFN-γ signaling through JAK1/2-induced STAT1 tyrosine phosphorylation, which was inhibited by INCB039110 or CEP-33779 (but not by PF-06651600) (Figure 1E). Fina", "n_hits": 8 }, { "paper": "Selective Janus kinase 1 inhibition resolves inflammation and restores hair growth offering a viable treatment option for alopecia areata", "quote": "eo/query/ acc.cgi?acc=GSE94235) and GSE94236 (mouse skin samples) (https://www.ncbi.nlm.nih.gov/geo/query/acc. cgi?acc=GSE94236). 2.4.6 | ALADIN scores IFN (Cxcl9, Cxcl10, Cxcl11, Stat1, and Mx1) and CTL (Cd8a, Gzmb, Icos, Prf1) ALADIN scores for the Taq- man data were calculated for each group as d", "n_hits": 7 } ], "grounded_in_corpus": true }, { "gene": "CYP19A1", "name": "Aromatase", "diseases": [ "AGA" ], "pathway": "Androgen signaling", "twin_node": "AND", "effect": "-", "role": "protector", "drugs": [ "aromatase inhibitors (anastrozole; promote hair loss by blocking this protective route)" ], "mechanism": "T→estradiol 전환; 여성 모낭에서 안드로겐 부하 완충.", "evidence_paper_ids": [ "41571202" ], "n_evidence": 1, "mention_count": 1, "sources": [ "discover:AGA", "extract", "seed" ], "in_model": true, "uncertain": false, "structure": { "accession": "P11511", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/P11511", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-P11511-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-P11511-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/P11511", "mean_plddt": 91.4, "plddt_band": "Very high (≥90)", "n_residues": 503, "local_pdb": "digital_twin\\data\\structures\\P11511_AF.pdb" }, "uniprot": "P11511", "uniprot_name": "Aromatase", "length": 503, "function": "A cytochrome P450 monooxygenase that catalyzes the conversion of C19 androgens, androst-4-ene-3,17-dione (androstenedione) and testosterone to the C18 estrogens, estrone and estradiol, respectively (PubMed:27702664, PubMed:2848247). Catalyzes three successive oxidations of C19 androgens: two conventional oxidations at C19 yielding 19-hydroxy and 19-oxo/19-aldehyde derivatives, followed by a third oxidative aromatization step that involves C1-beta hydrogen abstraction combined with cleavage of the C10-C19 bond to yield a phenolic A ring and formic acid (PubMed:20385561). Alternatively, the thir", "pdb_count": 11, "pdb_ids": [ "3EQM", "3S79", "3S7S", "4GL5", "4GL7", "4KQ8", "5JKV", "5JKW" ], "grounding": [ { "paper": "Alleviation of Androgenetic Alopecia with Aqueous Paeonia lactiflora and Poria cocos Extract Intake through Suppressing the Steroid Hormone and Inflammatory Pathway", "quote": "GA-PL group than in the AGA-Con group and similar to concentrations in the Normal-Con group, whereas serum 17β-estradiol concentrations showed the opposite pattern with increasing aromatase mRNA expression (p < 0.05). In the dorsal skin, DKK1 and NR3C2 mRNA expressions were significantly lower, but T", "n_hits": 9 }, { "paper": "Clinical Practice Guidelines for Menopause An Executive Summary and Recommendations Indian Menopause Society 2026.", "quote": "icacy and safety of ultra-low dose 0.005% estriol vaginal gel for the treatment of vulvovaginal atrophy in postmenopausal women with early breast cancer treated with nonsteroidal aromatase inhibitors: A phase II, randomized, double-blind, placebo-controlled trial. Menopause 2020;27:526-34. 154. Simo", "n_hits": 8 } ], "grounded_in_corpus": true }, { "gene": "EGFR", "name": "Epidermal growth factor receptor", "diseases": [ "AGA", "CIA", "Scarring" ], "pathway": "Growth factor", "twin_node": "DP", "effect": "+", "role": "modulator", "drugs": [ "Cetuximab", "EGFR inhibitor(유발)", "Erlotinib", "Gefitinib (inhibitors that perturb hair)" ], "mechanism": "EGFR 억제제 자체가 반흔성 탈모 유발; 모낭 항상성 필요.", "evidence_paper_ids": [ "PPR1134993" ], "n_evidence": 1, "mention_count": 1, "sources": [ "discover:CIA", "extract", "seed" ], "in_model": true, "uncertain": false, "structure": { "accession": "P00533", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/P00533", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-P00533-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-P00533-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/P00533", "mean_plddt": 75.9, "plddt_band": "Confident (70–90)", "n_residues": 1210, "local_pdb": "digital_twin\\data\\structures\\P00533_AF.pdb" }, "uniprot": "P00533", "uniprot_name": "Epidermal growth factor receptor", "length": 1210, "function": "Receptor tyrosine kinase binding ligands of the EGF family and activating several signaling cascades to convert extracellular cues into appropriate cellular responses (PubMed:10805725, PubMed:27153536, PubMed:2790960, PubMed:35538033). Known ligands include EGF, TGFA/TGF-alpha, AREG, epigen/EPGN, BTC/betacellulin, epiregulin/EREG and HBEGF/heparin-binding EGF (PubMed:12297049, PubMed:15611079, PubMed:17909029, PubMed:20837704, PubMed:27153536, PubMed:2790960, PubMed:7679104, PubMed:8144591, PubMed:9419975). Ligand binding triggers receptor homo- and/or heterodimerization and autophosphorylatio", "pdb_count": 351, "pdb_ids": [ "1IVO", "1M14", "1M17", "1MOX", "1NQL", "1XKK", "1YY9", "1Z9I" ], "grounding": [ { "paper": "JAK-STAT1 as therapeutic target for EGFR deficiency-associated inflammation and scarring alopecia", "quote": "Article JAK-STAT1 as therapeutic target for EGFR deficiency-associated inflammation and scarring alopecia Karoline Strobl1, Jörg Klufa1, Regina Jin 1, Lena Artner-Gent 1, Dana Krauß 1, Philipp Novoszel1, Johanna Strobl2, Georg Sta", "n_hits": 512 }, { "paper": "Role for the Epidermal Growth Factor Receptor in Chemotherapy-Induced Alopecia", "quote": "of cancer patients with chemotherapeutics like cyclophosphamide often causes alopecia as a result of premature and aberrant catagen. Because the epidermal growth factor receptor (EGFR) signals anagen hair follicles to enter catagen, we hypothesized that EGFR signaling may be involved in cyclophospha", "n_hits": 155 }, { "paper": "ISEV2025 Abstract Book.", "quote": "nitoring Phenotypic Analyzer Chip (GEMPAC), which pro- files a novel central nervous system (CNS) and glioma stem cell (GSC) biomarker panel (ATP1B2, EAAT2, CD24, CD44, CD133, and EGFR) on circulating sEVs. Methods: GEMPAC identifies a unique GBM signature in sEVs by targeting CNS-specific markers A", "n_hits": 52 }, { "paper": "Skin cancer understanding the journey of transformation from conventional to advanced treatment approaches.", "quote": "apeutic implications. Thereafter, oncogenes like RAS and other suppressor genes like CDKN2A and NOTCH undergo additional genetic alterations. Epi- dermal growth factor receptor (EGFR) upregulation is eventually caused by the activation of several signaling pathways, including the Nuclear factor kapp", "n_hits": 24 } ], "grounded_in_corpus": true }, { "gene": "GPX4", "name": "Phospholipid hydroperoxide glutathione peroxidase 4", "diseases": [ "AGA", "CIA" ], "pathway": "Oxidative stress", "twin_node": "APO", "effect": "-", "role": "protector", "drugs": [ "Ferrostatin-1 (tool)", "Liproxstatin-1 (tool)", "ferroptosis inhibitors / selenium (investigational)", "ferrostatin" ], "mechanism": "ferroptosis 방어; DP 세포 보호.", "evidence_paper_ids": [ "39947495" ], "n_evidence": 1, "mention_count": 1, "sources": [ "discover:AGA", "discover:HFSC", "extract", "seed" ], "in_model": true, "uncertain": false, "structure": { "accession": "P36969", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/P36969", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-P36969-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-P36969-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/P36969" }, "uniprot": "P36969", "uniprot_name": "Phospholipid hydroperoxide glutathione peroxidase GPX4", "length": 197, "function": "Essential antioxidant peroxidase that directly reduces phospholipid hydroperoxide even if they are incorporated in membranes and lipoproteins (PubMed:40281343). Can also reduce cholesterol hydroperoxide and thymine hydroperoxide (By similarity). Plays a key role in protecting cells from oxidative damage by preventing membrane lipid peroxidation (PubMed:40281343). Required to prevent cells from ferroptosis, a non-apoptotic cell death resulting from an iron-dependent accumulation of lipid reactive oxygen species (PubMed:24439385, PubMed:40281343). The presence of selenocysteine (Sec) versus Cys ", "pdb_count": 22, "pdb_ids": [ "2GS3", "2OBI", "5H5Q", "5H5R", "5H5S", "6ELW", "6HKQ", "6HN3" ], "grounding": [ { "paper": "Schizochytrium sp. Extracted Lipids Prevent Alopecia by Enhancing Antioxidation and Inhibiting Ferroptosis of Dermal Papilla Cells", "quote": "the key subunits of γ-glutamyl cysteine synthase and is the first-rate limiting enzyme for GSH synthesis. Ferroptosis is controlled by the composition of glutathione peroxidase 4 (GPX4). GSH acted as the reaction substrate of GPx4, and its depletion, could cause ferroptosis [49]. Solute Carrier Famil", "n_hits": 41 }, { "paper": "ISEV2025 Abstract Book.", "quote": "her affects the physio- logical response of GBM recipient cells. EVs from TMZ-untreated U87MG cells increase the expression of apoptotic (caspases 3/8/9) and ferroptotic (CD71 and GPX4) markers in recipient U251MG cells, while promoting a decrease in cell death markers in U87MG. The inactivation and", "n_hits": 36 }, { "paper": "Interdisciplinarity traditional Chinese medicine microneedles in skin disease treatment Recent advances and challenges.", "quote": "egrating TCM active ingredients and modern transdermal technology, as summarized in Table 2 [27]. For the successful treatment of hypertrophic scar, Shang et al. created a novel ferroptosis-based nanoplatform (Fig. 12) [196]. As a drug carrier, the platform makes use of zeolitic imidazolate framewor", "n_hits": 8 }, { "paper": "Rejuvenating senescent hair follicles a novel conjugated linoleic acid based nanovesicle approach to treat androgenic alopecia", "quote": "arious growth factors and promote the proliferation of DPCs [33]. Zeng et al. discovered that various PUFAs could treat hair loss by exerting antioxidant effects and inhibiting ferroptosis in DPCs [34]. In our study, we identified that CLA not only promoted HDPCs proliferation but relieved the DHT- ", "n_hits": 2 } ], "grounded_in_corpus": true }, { "gene": "IGF1", "name": "Insulin-like growth factor I", "diseases": [ "AGA" ], "pathway": "Growth factor", "twin_node": "DP", "effect": "+", "role": "protector", "drugs": [ "IGF-1 / growth-factor-based regenerative therapies (investigational)", "self-assembling IGF peptide" ], "mechanism": "DP 분비 발모 인자; AR-miR221-IGF1 축에서 하향.", "evidence_paper_ids": [ "41687550" ], "n_evidence": 1, "mention_count": 1, "sources": [ "discover:AGA", "seed" ], "in_model": true, "uncertain": false, "structure": { "accession": "P05019", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/P05019", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-P05019-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-P05019-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/P05019", "mean_plddt": 59.5, "plddt_band": "Low (50–70)", "n_residues": 195, "local_pdb": "digital_twin\\data\\structures\\P05019_AF.pdb" }, "uniprot": "P05019", "uniprot_name": "Insulin-like growth factor 1", "length": 195, "function": "The insulin-like growth factors, isolated from plasma, are structurally and functionally related to insulin but have a much higher growth-promoting activity. May be a physiological regulator of [1-14C]-2-deoxy-D-glucose (2DG) transport and glycogen synthesis in osteoblasts. Stimulates glucose transport in bone-derived osteoblastic (PyMS) cells and is effective at much lower concentrations than insulin, not only regarding glycogen and DNA synthesis but also with regard to enhancing glucose uptake. May play a role in synapse maturation (PubMed:21076856, PubMed:24132240). Ca(2+)-dependent exocyto", "pdb_count": 32, "pdb_ids": [ "1B9G", "1BQT", "1GZR", "1GZY", "1GZZ", "1H02", "1H59", "1IMX" ], "grounding": [ { "paper": "Self-assembling peptide inspired by insulin and type 1 insulin-like growth factor for the treatment of androgenetic alopecia", "quote": "PR China f Tianjin Eye Hospital, No. 4 Gansu Road, Heping District, Tianjin, 300020, PR China A R T I C L E I N F O Keywords: Peptide Self-assembly Insulin-like growth factor 1 (IGF-1) Hair regrowth Androgenetic alopecia (AGA) A B S T R A C T Androgenetic alopecia (AGA), the most prevalent form of h", "n_hits": 94 }, { "paper": "The AR miR-221 IGF-1 pathway mediates the pathogenesis of androgenetic alopecia", "quote": ". Sci. 2023, Vol. 19 https://www.ijbs.com 3307 International Journal of Biological Sciences 2023; 19(11): 3307-3323. doi: 10.7150/ijbs.80481 Research Paper The AR/miR-221/IGF-1 pathway mediates the pathogenesis of androgenetic alopecia Kaitao Li†, Yang Sun†, Shizhao Liu†, Yi Zhou, Qian Qu, Gaofeng W", "n_hits": 83 }, { "paper": "Drug Delivery System Based On Minoxidil Nanoparticles Promotes Haira Growth in C57BL6 Mice", "quote": ". C57BL/6 mice were used to evaluate hair-growth effects. The expression levels of mRNA and protein for vascular endothelial growth factor (VEGF) and insulin-like growth factor-1 (IGF-1) were determined by real-time PCR and ELISA methods, respectively. Results: The ratio of solid-MXD was approximate", "n_hits": 35 }, { "paper": "Hair Growth Effect of DN106212 in C57BL 6 Mouse and Its Network Pharmacological Mechanism of Action", "quote": "2017, 309, 729–738. [CrossRef] 52. Hu, Z.-Q.; Hou, C.; Miao, Y.; Wang, J.; Wang, X.; Chen, C.-Y. Collagenase IV plays an important role in regulating hair cycle by inducing VEGF, IGF-1, and TGF-β expression. Drug Des. Dev. Ther. 2015, 9, 5373–5383. [CrossRef] 53. Semon, H.C. An Atlas of the Commoner", "n_hits": 22 } ], "grounded_in_corpus": true }, { "gene": "LEF1", "name": "Lymphoid enhancer-binding factor 1", "diseases": [ "AGA", "CIA" ], "pathway": "Wnt/β-catenin", "twin_node": "Wnt", "effect": "+", "role": "protector", "drugs": [], "mechanism": "β-catenin 협력 전사인자, 모발 분화.", "evidence_paper_ids": [ "41192849" ], "n_evidence": 1, "mention_count": 1, "sources": [ "discover:AGA", "extract", "seed" ], "in_model": true, "uncertain": false, "structure": { "accession": "Q9UJU2", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/Q9UJU2", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-Q9UJU2-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-Q9UJU2-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/Q9UJU2", "mean_plddt": 57.0, "plddt_band": "Low (50–70)", "n_residues": 399, "local_pdb": "digital_twin\\data\\structures\\Q9UJU2_AF.pdb" }, "uniprot": "Q9UJU2", "uniprot_name": "Lymphoid enhancer-binding factor 1", "length": 399, "function": "Transcription factor that binds DNA in a sequence-specific manner (PubMed:2010090). Participates in the Wnt signaling pathway (By similarity). Activates transcription of target genes in the presence of CTNNB1 and EP300 (By similarity). PIAG antagonizes both Wnt-dependent and Wnt-independent activation by LEF1 (By similarity). TLE1, TLE2, TLE3 and TLE4 repress transactivation mediated by LEF1 and CTNNB1 (PubMed:11266540). Regulates T-cell receptor alpha enhancer function (PubMed:19653274). Required for IL17A expressing gamma-delta T-cell maturation and development, via binding to regulator loci", "pdb_count": 0, "pdb_ids": [], "grounding": [ { "paper": "‘Cyclic alopecia’ in Msx2 mutants defects in hair cycling and hair shaft differentiation", "quote": "Noggin abolishes hair filament differentiation but not that of the IRS (Kulessa et al., 2000). The Wnt signaling pathway is also implicated in hair follicle morphogenesis, with Lef1 constituting a key nuclear effector in this pathway (Zhou et al., 1995; DasGupta and Fuchs, 1999; Millar et al., 1999)", "n_hits": 18 }, { "paper": "Gene therapy for alopecia in type II rickets model rats using vitamin D receptor-expressing adenovirus vector", "quote": "Scale bar; 200 µm. 5 Vol.:(0123456789) Scientific Reports | (2023) 13:18528 | https://doi.org/10.1038/s41598-023-45594-2 www.nature.com/scientificreports/ Enhancement of Lef1 gene expression in VDR‑AdV‑injected area of Vdr‑KO rats In Vdr-KO rats, the expression of Lef1 (a Wnt signaling-related gene)", "n_hits": 12 }, { "paper": "Molecular signatures and signaling interactions of the hair follicle stem cell niche.", "quote": "labeling system that enabled high enrichment of these cell types from the skin during the telogen phase of the hair growth cycle (Figure 1b). We generated K14-H2BGFP;Crabp1-GFP;Lef1-RFP triple transgenic reporter mice and digested postnatal day P22 back skins to obtain single cells from epidermis an", "n_hits": 12 }, { "paper": "Sulforaphane-Rich Broccoli Sprout Extract Promotes Hair Regrowth in an Androgenetic Alopecia Mouse Model via Enhanced Dihy drotestosterone Metabolism", "quote": "this pathway in a testosterone-induced AGA mouse model, we Int. J. Mol. Sci. 2025, 26, 7467 15 of 33 analyzed the expression of β-catenin and lymphoid enhancer-binding factor 1 (Lef-1) in dorsal skin tissues using Western blot. Figure 6. In vivo activation of 3α-HSD enzymes in the liver 15 days post", "n_hits": 9 } ], "grounded_in_corpus": true }, { "gene": "PTGDS", "name": "Prostaglandin-H2 D-isomerase (L-PGDS)", "diseases": [ "AGA" ], "pathway": "Prostaglandin", "twin_node": "APO", "effect": "+", "role": "driver", "drugs": [ "PGD2 pathway inhibitor", "PTGDR2/CRTH2 antagonists targeting this axis (investigational)" ], "mechanism": "대머리 두피 상승; PGD2 생성→모발 성장 억제.", "evidence_paper_ids": [ "41625414" ], "n_evidence": 1, "mention_count": 1, "sources": [ "discover:AGA", "seed" ], "in_model": true, "uncertain": false, "structure": { "accession": "P41222", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/P41222", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-P41222-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-P41222-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/P41222", "mean_plddt": 87.8, "plddt_band": "Confident (70–90)", "n_residues": 190, "local_pdb": "digital_twin\\data\\structures\\P41222_AF.pdb" }, "uniprot": "P41222", "uniprot_name": "Prostaglandin-H2 D-isomerase", "length": 190, "function": "Catalyzes the conversion of PGH2 to PGD2, a prostaglandin involved in smooth muscle contraction/relaxation and a potent inhibitor of platelet aggregation (PubMed:20667974). Involved in a variety of CNS functions, such as sedation, NREM sleep and PGE2-induced allodynia, and may have an anti-apoptotic role in oligodendrocytes. Binds small non-substrate lipophilic molecules, including biliverdin, bilirubin, retinal, retinoic acid and thyroid hormone, and may act as a scavenger for harmful hydrophobic molecules and as a secretory retinoid and thyroid hormone transporter. Possibly involved in devel", "pdb_count": 17, "pdb_ids": [ "2WWP", "3O19", "3O22", "3O2Y", "4IMN", "4IMO", "4ORR", "4ORS" ], "grounding": [ { "paper": "Prostaglandin D2 Inhibits Hair Growth and Is Elevated in Bald Scalp of Men with Androgenetic Alopecia", "quote": "ndin D2 synthase (PTGDS) is elevated at the mRNA and protein levels in bald scalp compared to haired scalp of men with AGA. The product of PTGDS enzyme activity, prostaglandin D2 (PGD2), is similarly elevated in bald scalp. During normal follicle cycling in mice, Ptgds and PGD2 levels increase immed", "n_hits": 199 }, { "paper": "Use of genetics in the prediction of success in male pattern hair loss therapy and mechanistic studies.", "quote": "dermal papilla integrity (Heilmann-Heimbach et al., 2017; Michel et al., 2017; Li et al., 2024). Functional studies of bald versus non-bald scalp confirm that prostaglandin D2 (PGD2) and its receptor GPR44 are upregulated in balding areas and that PGD2 directly inhibits hair growth, while prostaglan", "n_hits": 14 }, { "paper": "Expanding the therapeutic landscape of minoxidil for androgenetic alopecia topical, oral and sublingual formulations.", "quote": ". Prostaglandins are lipid mediators known to influence HF cycling. Specifically, prostaglandin E2 (PGE2) and prostaglandin F2α (PGF2α) promote hair growth whereas prostaglandin D2 (PGD2) is associated with hair growth inhibition and miniaturisation (Johnstone and Albert, 2002). Prostaglandins are pro", "n_hits": 2 } ], "grounded_in_corpus": true }, { "gene": "PTGFR", "name": "Prostaglandin F2-alpha receptor", "diseases": [ "AGA" ], "pathway": "Prostaglandin", "twin_node": "DP", "effect": "+", "role": "protector", "drugs": [ "bimatoprost", "latanoprost" ], "mechanism": "PGF2α 유사체 발모 촉진(속눈썹·두피).", "evidence_paper_ids": [ "PPR1164225" ], "n_evidence": 1, "mention_count": 1, "sources": [ "discover:AGA", "extract", "seed" ], "in_model": true, "uncertain": false, "structure": { "accession": "P43088", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/P43088", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-P43088-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-P43088-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/P43088", "mean_plddt": 80.6, "plddt_band": "Confident (70–90)", "n_residues": 359, "local_pdb": "digital_twin\\data\\structures\\P43088_AF.pdb" }, "uniprot": "P43088", "uniprot_name": "Prostaglandin F2-alpha receptor", "length": 359, "function": "Receptor for prostaglandin F2-alpha (PGF2-alpha). The activity of this receptor is mediated by G proteins which activate a phosphatidylinositol-calcium second messenger system. Initiates luteolysis in the corpus luteum (By similarity). Isoforms 2 to 7 do not bind PGF2-alpha but are proposed to modulate signaling by participating in variant receptor complexes; heterodimers between isoform 1 and isoform 5 are proposed to be a receptor for prostamides including the synthetic analog bimatoprost", "pdb_count": 8, "pdb_ids": [ "8IQ4", "8IQ6", "8IUK", "8IUL", "8IUM", "8XJK", "8XJL", "8XJM" ], "grounding": [ { "paper": "Use of genetics in the prediction of success in male pattern hair loss therapy and mechanistic studies.", "quote": "din balance and follicular miniaturisation. In contrast, prostaglandin F2α signalling through PTGFR is associated with pro-anagen effects, and pharmacological analogues such as latanoprost have demonstrated modest follicular enlargement in small human studies (Blume-Peytavi et al., 2012; Suchonwanit", "n_hits": 20 }, { "paper": "Prostaglandin D2 Inhibits Hair Growth and Is Elevated in Bald Scalp of Men with Androgenetic Alopecia", "quote": "hibit hair growth, likely through the GPR44 receptor. DISCUSSION Recent evidence has illustrated a role for prostaglandins in regulating hair growth. For example, the PGF2α analog latanoprost is Food and Drug Administration (FDA)–approved and routinely used clinically to enhance hair growth of human", "n_hits": 12 }, { "paper": "Statement from the frontal fibrosing alopecia international expert alliance SOFFIA 2024.", "quote": "the involved scalp margin. • Topical minoxidil can be applied to eyebrows and has an optimal strength of 5% not 2%. Topical prostaglandins • Topical bimatoprost 0.03% or topical latanoprost 0.005% can be applied to the eyebrows. • Topical bimatoprost 0.03% or topical latanoprost 0.005% is not an eff", "n_hits": 4 }, { "paper": "Schizochytrium sp. Extracted Lipids Prevent Alopecia by Enhancing Antioxidation and Inhibiting Ferroptosis of Dermal Papilla Cells", "quote": "lenic acid (18:3; ω-3; α-LA), eicosapentaenoic acid (20:5; ω-3; EPA), and docosahexaenoic acid (22:6; ω-3; DHA) [27]. Compounds that are structurally similar to ω-3 PUFAs, such as latanoprost, isopropyl unoprostone, and bimatoprost, induce hair growth in both mice and humans [28,29]. Moreover, a mac", "n_hits": 3 } ], "grounded_in_corpus": true }, { "gene": "SFRP1", "name": "Secreted frizzled-related protein 1", "diseases": [ "AGA" ], "pathway": "Wnt/β-catenin", "twin_node": "Wnt", "effect": "-", "role": "driver", "drugs": [ "WAY-316606 (SFRP1 inhibitor, investigational)", "WAY-316606 (SFRP1 inhibitor, preclinical)", "WAY-316606(inhibitor)", "mRNA epigenomic SFRP1 suppressor (Omega Therapeutics, preclinical)" ], "mechanism": "Wnt 분비형 억제자.", "evidence_paper_ids": [ "41751951" ], "n_evidence": 1, "mention_count": 1, "sources": [ "discover:AGA", "discover:recent", "seed" ], "in_model": true, "uncertain": false, "structure": { "accession": "Q8N474", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/Q8N474", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-Q8N474-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-Q8N474-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/Q8N474", "mean_plddt": 79.6, "plddt_band": "Confident (70–90)", "n_residues": 314, "local_pdb": "digital_twin\\data\\structures\\Q8N474_AF.pdb" }, "uniprot": "Q8N474", "uniprot_name": "Secreted frizzled-related protein 1", "length": 314, "function": "Soluble frizzled-related proteins (sFRPS) function as modulators of Wnt signaling through direct interaction with Wnts. They have a role in regulating cell growth and differentiation in specific cell types. SFRP1 decreases intracellular beta-catenin levels (By similarity). Has antiproliferative effects on vascular cells, in vitro and in vivo, and can induce, in vivo, an angiogenic response. In vascular cell cycle, delays the G1 phase and entry into the S phase (By similarity). In kidney development, inhibits tubule formation and bud growth in metanephroi (By similarity). Inhibits WNT1/WNT4-med", "pdb_count": 0, "pdb_ids": [], "grounding": [ { "paper": "Molecular signatures and signaling interactions of the hair follicle stem cell niche.", "quote": "upplementary Table S2). Finally, initial inspection of the signatures revealed a robust presence of previously known DP genes such as Corin, Enpp2, Hhip and Wif1, the BuSC genes Sfrp1 and Sox9, and the HGSC genes Shh and Msx2 (Figure 2g). Overall, our comprehensive transcriptome analysis in four dis", "n_hits": 10 }, { "paper": "Exosomes Secreted from Adipose-Derived Stem Cells Are a Potential Treatment Agent for Immune-Mediated Alopecia", "quote": "3A (P < 0:001) and AXIN2 (P < 0:0001) in both the ADSC-Exos and ADSC-Exos+MNX groups were significantly upregulated. LEF1 (P < 0:01) was upregulated in the ADSC-Exos+MNX group, and SFRP1 (P < 0:01) was downregulated in the ADSC-Exos group (Figure 6(d)). The top 30 KEGG enriched pathways of DEGs (P < ", "n_hits": 6 }, { "paper": "Kartogenin regulates hair growth and hair cycling", "quote": "134(3):610-619. 3. Hawkshaw NJ, Hardman JA, Haslam IS, et al. Identifying novel strategies for treating human hair loss disorders: Cyclosporine A suppresses the Wnt inhibitor, SFRP1, in the dermal papilla of human scalp hair follicles PLoS Biol. May 2018;16(5):e2003705. 4. Naruse T, Aoki M, Fujimoto", "n_hits": 2 }, { "paper": "Modified Huanjingjian Prevents Chemotherapy-Induced Alopecia by Inhibiting Genomic DNA Methylation of the Wnt Signaling Pathway in Mice", "quote": "Powered by TCPDF (www.tcpdf.org) 42. Sunkara RR, Mehta D, Sarate RM, Waghmare SK. BMP-AKT-GSK3β signaling restores hair follicle stem cells decrease associated with loss of Sfrp1. Stem Cells. 2022;40(9):802–817. doi:10.1093/stmcls/sxac041 43. Katoh M, Katoh M. CER1 is a common target of WNT and NODA", "n_hits": 2 } ], "grounded_in_corpus": true }, { "gene": "SOX9", "name": "Transcription factor SOX-9", "diseases": [ "AGA" ], "pathway": "HFSC niche", "twin_node": "HFSC", "effect": "+", "role": "protector", "drugs": [], "mechanism": "모낭 bulge 줄기세포 정체성 유지.", "evidence_paper_ids": [ "41629248" ], "n_evidence": 1, "mention_count": 1, "sources": [ "discover:HFSC", "extract", "seed" ], "in_model": true, "uncertain": false, "structure": { "accession": "P48436", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/P48436", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-P48436-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-P48436-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/P48436", "mean_plddt": 56.0, "plddt_band": "Low (50–70)", "n_residues": 509, "local_pdb": "digital_twin\\data\\structures\\P48436_AF.pdb" }, "uniprot": "P48436", "uniprot_name": "Transcription factor SOX-9", "length": 509, "function": "Transcription factor that plays a key role in chondrocytes differentiation and skeletal development (PubMed:24038782). Specifically binds the 5'-ACAAAG-3' DNA motif present in enhancers and super-enhancers and promotes expression of genes important for chondrogenesis, including cartilage matrix protein-coding genes COL2A1, COL4A2, COL9A1, COL11A2 and ACAN, SOX5 and SOX6 (PubMed:8640233). Also binds to some promoter regions (By similarity). Plays a central role in successive steps of chondrocyte differentiation (By similarity). Absolutely required for precartilaginous condensation, the first st", "pdb_count": 1, "pdb_ids": [ "4EUW" ], "grounding": [ { "paper": "Disrupted cholesterol biosynthesis and hair follicle stem cell impairment in the onset of alopecia", "quote": "eported as means with standard deviation, and a P-value below 0.05 was considered statistically significant 3. Results 3.1. Down-regulated expression of stem cell marker genes (SOX9, LGR5, SHH, WNT 5A) in PCA A gene expression study using real-time PCR data showed that hair follicle stem cell marker", "n_hits": 48 }, { "paper": "JAK-STAT1 as therapeutic target for EGFR deficiency-associated inflammation and scarring alopecia", "quote": "ig. 1H). Skin sections and epidermal whole mounts of older mice (5–7 M) indicated the complete degradation of the hair follicle structure together with the stem cell markers CD34, Sox9, and Krt15 (Figs. 1I and EV1F). These data demonstrate that hair follicle-specific EGFR protects from microbiota-dri", "n_hits": 30 }, { "paper": "Tremella polysaccharide microneedles loaded with magnetic dental pulp stem cell intracellular vesicles used for androgenic alopecia", "quote": "(2025) 16:161 PVDF membrane was sealed with 5% skim milk and incubated with primary antibody at 4 °C for 15 h, including anti-CD206(Proteintech,60143-1-Ig,1:2000), anti-SOX9(Proteintech,67439-1-Ig,1:2000),anti- iNOS(Proteintech,18985-1-AP,1:2000), anti-TSG101 (Proteintech, 67381-1-Ig, 1: 1000), anti", "n_hits": 24 }, { "paper": "Engineered collagen XVII-loaded dissolving microneedle patch for promoting hair regrowth in androgenic alopecia", "quote": "sed follicle density, anagen-phase transition and CD31þ vascularization. Histological analysis revealed restored follicle structure and upregulated β-cateninþ and SRY-box gene 9 (SOX9þ), indicating activation of stem cell and prolif­ erative signaling pathways. The rhCOL17p-MN also demonstrated low ", "n_hits": 22 } ], "grounded_in_corpus": true }, { "gene": "TGFB1", "name": "Transforming growth factor beta-1", "diseases": [ "AA", "AGA", "CIA" ], "pathway": "BMP/TGFβ", "twin_node": "APO", "effect": "+", "role": "driver", "drugs": [ "Fresolimumab (anti-TGF-beta, experimental)", "TGF-beta inhibitors (investigational)", "TGFβ inhibitor" ], "mechanism": "AR 하류 catagen 유도; 모기질 apoptosis (YH0618 표적).", "evidence_paper_ids": [ "41571202", "41579939" ], "n_evidence": 2, "mention_count": 1, "sources": [ "discover:AGA", "discover:CIA", "extract", "seed" ], "in_model": true, "uncertain": false, "structure": { "accession": "P01137", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/P01137", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-P01137-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-P01137-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/P01137", "mean_plddt": 79.6, "plddt_band": "Confident (70–90)", "n_residues": 390, "local_pdb": "digital_twin\\data\\structures\\P01137_AF.pdb" }, "uniprot": "P01137", "uniprot_name": "Transforming growth factor beta-1 proprotein", "length": 390, "function": "Transforming growth factor beta-1 proprotein: Precursor of the Latency-associated peptide (LAP) and Transforming growth factor beta-1 (TGF-beta-1) chains, which constitute the regulatory and active subunit of TGF-beta-1, respectively", "pdb_count": 17, "pdb_ids": [ "1KLA", "1KLC", "1KLD", "3KFD", "4KV5", "5FFO", "5VQP", "6OM2" ], "grounding": [ { "paper": "ISEV2025 Abstract Book.", "quote": "B-I00 project from the Ministry of Science and Innovation of the Government (Spain); Consorzio Interuniversitario Nazionale per la Scienza e Tecnologia dei Materiali—INSTM. OF10.4 TGF-β-activated cancer-associated fibroblasts remodel the tumour microenvironment through extracellular vesicle surface-", "n_hits": 59 }, { "paper": "Deletion of hypoxia-inducible factor prolyl 4-hydroxylase 2 in FoxD1-lineage mesenchymal cells leads to congenital truncal alopecia", "quote": "the depletion of Hif-p4h-2 led to HIF stabiliza- tion and dysregulation of multiple genes involved in keratin formation, HF differentiation, and HIF, transforming growth factor β (TGF-β), and Notch signaling. We hypothesize that the failure of HF cycling is likely to be mechanistically caused by dis", "n_hits": 35 }, { "paper": "iTRAQ-based quantitative proteomics revealing the therapeutic mechanism of a medicinal and edible formula YH0618 in reducing doxorubicin-induced alopecia by targeting and TGF-b Smad3 pathway", "quote": "RAQ-based quantitative proteomics revealing the therapeutic mechanism of a medicinal and edible formula YH0618 in reducing doxorubicin-induced alopecia by targeting keratins and TGF-β/ Smad3 pathway Renkai Li a,b,1, Mingxia Chen a,1, Danxi Yan a, Liang Chen c, Mandi Lin d, Bohui Deng a, Likai Zhuang", "n_hits": 16 }, { "paper": "iTRAQ-based quantitative proteomics revealing the therapeutic mechanism of a medicinal and edible formula YH0618 in reducing doxorubicin-induced alopecia by targeting keratins and TGF-β Smad3 pathway", "quote": "RAQ-based quantitative proteomics revealing the therapeutic mechanism of a medicinal and edible formula YH0618 in reducing doxorubicin-induced alopecia by targeting keratins and TGF-β/ Smad3 pathway Renkai Li a,b,1, Mingxia Chen a,1, Danxi Yan a, Liang Chen c, Mandi Lin d, Bohui Deng a, Likai Zhuang", "n_hits": 16 } ], "grounded_in_corpus": true }, { "gene": "FGF7", "name": "Keratinocyte growth factor (FGF7/KGF)", "diseases": [ "AGA", "CIA" ], "pathway": "Growth factor", "twin_node": "DP", "effect": "+", "role": "protector", "drugs": [ "FGF7 / growth-factor regenerative therapies (investigational)", "Palifermin (recombinant KGF)" ], "mechanism": "DP→상피 발모 신호.", "evidence_paper_ids": [ "39922517" ], "n_evidence": 1, "mention_count": 0, "sources": [ "discover:AGA", "discover:CIA", "extract", "seed" ], "in_model": true, "uncertain": false, "structure": { "accession": "P21781", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/P21781", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-P21781-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-P21781-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/P21781", "mean_plddt": 82.4, "plddt_band": "Confident (70–90)", "n_residues": 194, "local_pdb": "digital_twin\\data\\structures\\P21781_AF.pdb" }, "uniprot": "P21781", "uniprot_name": "Fibroblast growth factor 7", "length": 194, "function": "Plays an important role in the regulation of embryonic development, cell proliferation and cell differentiation. Required for normal branching morphogenesis. Growth factor active on keratinocytes. Possible major paracrine effector of normal epithelial cell proliferation", "pdb_count": 0, "pdb_ids": [], "grounding": [ { "paper": "BFNB Enhances Hair Growth in C57BL 6 Mice through the", "quote": "Citation: Pérez-Mora, S.; Ocampo-López, J.; Gómez-García, M.d.C.; Pérez-Ishiwara, D.G. BFNB Enhances Hair Growth in C57BL/6 Mice through the Induction of EGF and FGF7 Factors and the PI3K-AKT-β-Catenin Pathway. Int. J. Mol. Sci. 2023, 24, 12110. https:// doi.org/10.3390/ijms241512110 Academic Editor", "n_hits": 32 }, { "paper": "Subcutaneous injection of genetically engineered exosomes for androgenic alopecia treatment", "quote": "e-based targeted delivery platform, designated as EX104, through the engineering of HEK-293 cells to express a combination of therapeutical molecules, including WNT10B, VEGFA, and FGF7. EX104 reversed the hair follicle miniaturization phenotype in DHT-induced DPCs. Furthermore, it demonstrated signi", "n_hits": 16 }, { "paper": "Restoration of follicular β-catenin signaling by mesenchymal stem cells promotes hair growth in mice with androgenetic alopecia", "quote": "CG GTC​TGA​TCT​CTT​TCC​CCA​ACTCT​ Cdk4 (mouse) CTG​AAC​CGC​TTT​GGC​AAG​AC GCC​CTC​TCT​TAT​CGC​CAG​AT β-catenin (mouse) GTT​CGC​CTT​CAT​TAT​GGA​CTGCC​ ATA​GCA​CCC​TGT​TCC​CGC​AAAG​ Fgf7 (mouse) TGG​GCA​CTA​TAT​CTC​TAG​CTTGC​ GGG​TGC​GAC​AGA​ACA​GTC​T Gapdh (mouse) CAT​CAC​TGC​CAC​CCA​GAA​GACTG​ ATG​C", "n_hits": 14 }, { "paper": "Deletion of hypoxia-inducible factor prolyl 4-hydroxylase 2 in FoxD1-lineage mesenchymal cells leads to congenital truncal alopecia", "quote": "8 P21 P24 0.0 1.0 2.0 3.0 4.0 5.0 6.0 A Control cKO Keratin 1 Keratin 5 Loricrin C Relative Krt5 mRNA * Relative Krt1 mRNA ** * Relative Krt10 mRNA ** * Relative Lor mRNA Relative Kgf mRNA Relative Krt15 mRNA Control cKO Skin overview Hair follicle Skin surface Hair shaft B Relative Krt14 mRNA *** *", "n_hits": 11 } ], "grounded_in_corpus": true }, { "gene": "SIRT1", "name": "NAD-dependent deacetylase sirtuin-1", "diseases": [ "AGA", "CIA" ], "pathway": "PI3K-AKT-mTOR", "twin_node": "DP", "effect": "+", "role": "protector", "drugs": [ "Jiawei Erzhiwan", "resveratrol (SIRT1 activator, investigational)" ], "mechanism": "SIRT1-JNK-p38 축; 산화·노화 방어.", "evidence_paper_ids": [ "41371370" ], "n_evidence": 1, "mention_count": 0, "sources": [ "discover:AGA", "extract", "seed" ], "in_model": true, "uncertain": false, "structure": { "accession": "Q96EB6", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/Q96EB6", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-Q96EB6-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-Q96EB6-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/Q96EB6", "mean_plddt": 65.0, "plddt_band": "Low (50–70)", "n_residues": 747, "local_pdb": "digital_twin\\data\\structures\\Q96EB6_AF.pdb" }, "uniprot": "Q96EB6", "uniprot_name": "NAD-dependent protein deacetylase sirtuin-1", "length": 747, "function": "NAD-dependent protein deacetylase that links transcriptional regulation directly to intracellular energetics and participates in the coordination of several separated cellular functions such as cell cycle, response to DNA damage, metabolism, apoptosis and autophagy (PubMed:11672523, PubMed:12006491, PubMed:14976264, PubMed:14980222, PubMed:15126506, PubMed:15152190, PubMed:15205477, PubMed:15469825, PubMed:15692560, PubMed:16079181, PubMed:16166628, PubMed:16892051, PubMed:16998810, PubMed:17283066, PubMed:17290224, PubMed:17334224, PubMed:17505061, PubMed:17612497, PubMed:17620057, PubMed:179", "pdb_count": 9, "pdb_ids": [ "4I5I", "4IF6", "4IG9", "4KXQ", "4ZZH", "4ZZI", "4ZZJ", "5BTR" ], "grounding": [ { "paper": "Jiawei Erzhiwan Ameliorates Androgenetic Alopecia by Regulating the SIRT1 JNK p38 MAPK Pathway", "quote": "O R I G I N A L R E S E A R C H Jiawei Erzhiwan Ameliorates Androgenetic Alopecia by Regulating the SIRT1/JNK/p38 MAPK Pathway Zhiguang Huang1,2,*, Yuanyuan Li3,*, Yixin Xie1,2,*, Hangjie Fu2,4, Zhiwei Weng1,2, Jianchang Yuan1,2, Lan Wu1,2, Weizhou Lin1,2, Yi Cao3, Bin Ding 1,2,5 1S", "n_hits": 46 }, { "paper": "Modulating immune responses in alopecia therapeutic insights and potential targets of antisense oligonucleotides", "quote": "mon under­ lying molecular pathways, particularly involving the dysregulation of microRNAs (miRNAs) and key cellular signaling molecules [8–12]. One such molecule of interest is SIRT1, a mem­ ber of the sirtuin family of NAD+dependent protein BMC Immunology *Correspondence: Hyun-Jeong Cho hjcho@kony", "n_hits": 43 }, { "paper": "Extracellular vesicles in age-related diseases disease pathogenesis, intervention, and biomarker.", "quote": "n endothelial cells (HUVECs), EVs released by the cells deliver elevated amount of miR-21-5p and miR-217, which impair the expression of DNA methyl- transferase 1 and Sirtuin-1 (SIRT1), thus affecting DNA methylation and cells replication ability [19]. Other stud- ies have also discovered that EVs f", "n_hits": 11 } ], "grounded_in_corpus": true }, { "gene": "VDR", "name": "Vitamin D3 receptor", "diseases": [ "AGA", "CIA", "Other" ], "pathway": "Nuclear receptor", "twin_node": "HFSC", "effect": "+", "role": "protector", "drugs": [ "Calcitriol / vitamin D analogs (adjunctive)", "VDR gene therapy", "calcitriol analog" ], "mechanism": "모낭 주기 개시 필수; 결핍 시 rickets-type alopecia.", "evidence_paper_ids": [ "PPR1146292" ], "n_evidence": 1, "mention_count": 0, "sources": [ "discover:CIA", "extract", "seed" ], "in_model": true, "uncertain": false, "structure": { "accession": "P11473", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/P11473", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-P11473-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-P11473-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/P11473", "mean_plddt": 83.6, "plddt_band": "Confident (70–90)", "n_residues": 427, "local_pdb": "digital_twin\\data\\structures\\P11473_AF.pdb" }, "uniprot": "P11473", "uniprot_name": "Vitamin D3 receptor", "length": 427, "function": "Nuclear receptor for calcitriol, the active form of vitamin D3 which mediates the action of this vitamin on cells (PubMed:10678179, PubMed:15728261, PubMed:16913708, PubMed:28698609, PubMed:37478846). Enters the nucleus upon vitamin D3 binding where it forms heterodimers with the retinoid X receptor/RXR (PubMed:28698609). The VDR-RXR heterodimers bind to specific response elements on DNA and activate the transcription of vitamin D3-responsive target genes (PubMed:28698609). Plays a central role in calcium homeostasis (By similarity). Also functions as a receptor for the secondary bile acid lit", "pdb_count": 52, "pdb_ids": [ "1DB1", "1IE8", "1IE9", "1KB2", "1KB4", "1KB6", "1S0Z", "1S19" ], "grounding": [ { "paper": "Gene therapy for alopecia in type II rickets model rats using vitamin D receptor-expressing adenovirus vector", "quote": "iyu Nishikawa 1, Shinichi Ikushiro 1, Tomoko Nakanishi 3, Shigeto Sato 3, Kaori Yasuda 1 & Toshiyuki Sakaki 1* Type II rickets is a hereditary disease caused by a mutation in the vitamin D receptor (VDR) gene. The main symptoms of this disease are bone dysplasia and alopecia. Bone dysplasia can be a", "n_hits": 239 }, { "paper": "Targeted Expression of Human Vitamin D Receptor in the Skin Promotes the Initiation of the Postnatal Hair Follicle Cycle and Rescues the Alopecia in Vitamin D Receptor Null Mice", "quote": "Targeted Expression of Human Vitamin D Receptor in the Skin Promotes the Initiation of the Postnatal Hair Follicle Cycle and Rescues the Alopecia in Vitamin D Receptor Null Mice Juan Kong, Xiao Jian Li,² Donna Gavin,² Yulei Jia", "n_hits": 124 }, { "paper": "Targeted ablation of the vitamin D receptor An animal model of vitamin D-dependent rickets type II with alopecia", "quote": "Proc. Natl. Acad. Sci. USA Vol. 94, pp. 9831–9835, September 1997 Medical Sciences Targeted ablation of the vitamin D receptor: An animal model of vitamin D-dependent rickets type II with alopecia YAN CHUN LI*, ALISON E. PIRRO*, MICHAEL AMLING†‡, GUNTER DELLING‡, ROLAND BARON†, RODERICK BRONSON§, AN", "n_hits": 45 }, { "paper": "Vitamin D3 Analogs Stimulate Hair Growth in Nude Mice", "quote": "Pharmaceuticals (L.B.), DK-2750 Ballerup, Denmark The active form of vitamin D3 can regulate epidermal kera- tinization by inducing terminal differentiation; and mice lacking the vitamin D receptor display defects leading to post- natal alopecia. These observations implicate the vitamin D3 pathway i", "n_hits": 22 } ], "grounded_in_corpus": true }, { "gene": "BMP2", "name": "Bone morphogenetic protein 2", "diseases": [ "AGA", "CIA" ], "pathway": "BMP/TGFβ", "twin_node": "BMP", "effect": "+", "role": "modulator", "drugs": [ "BMP antagonists (investigational)" ], "mechanism": "모낭 telogen 유지 신호(생리적 조절).", "evidence_paper_ids": [], "n_evidence": 0, "mention_count": 0, "sources": [ "discover:AGA", "discover:CIA", "seed" ], "in_model": true, "uncertain": false, "structure": { "accession": "P12643", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/P12643", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-P12643-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-P12643-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/P12643", "mean_plddt": 79.6, "plddt_band": "Confident (70–90)", "n_residues": 396, "local_pdb": "digital_twin\\data\\structures\\P12643_AF.pdb" }, "uniprot": "P12643", "uniprot_name": "Bone morphogenetic protein 2", "length": 396, "function": "Growth factor of the TGF-beta superfamily that plays essential roles in many developmental processes, including cardiogenesis, neurogenesis, and osteogenesis (PubMed:18436533, PubMed:24362451, PubMed:31019025). Induces cartilage and bone formation (PubMed:3201241). Initiates the canonical BMP signaling cascade by associating with type I receptor BMPR1A and type II receptor BMPR2 (PubMed:15064755, PubMed:17295905, PubMed:18436533). Once all three components are bound together in a complex at the cell surface, BMPR2 phosphorylates and activates BMPR1A (PubMed:7791754). In turn, BMPR1A propagates", "pdb_count": 21, "pdb_ids": [ "1ES7", "1REU", "1REW", "2GOO", "2H62", "2H64", "2QJ9", "2QJA" ], "grounding": [ { "paper": "ISEV2025 Abstract Book.", "quote": "for bone regeneration. Methods: Human bone marrow-derived stromal cells (hBM- SCs) microtissues were differentiated in chondrogenic medium with/without bone morphogenic protein 2 (BMP2) for 21 days. Following this, constructs were either maintained in chondro- genic medium or switched to hypertrophi", "n_hits": 11 }, { "paper": "Low-frequency electromagnetic fields ameliorate testosterone-induced androgenetic alopecia in mice through LncRNA H19 miR-214-5p β-catenin signal pathway", "quote": "d invasion under hypoxic conditions [14]. Similar to this, H19 promotes the dif­ ferentiation of human bone marrow mesenchymal stem cells (hBMMSCs) by controlling the miR-214-5p/BMP2 axis during osteo­ blastic differentiation [15]. These findings underscore the capacity of lncRNA H19 to modulate miR", "n_hits": 5 }, { "paper": "Overexpression of MYB in the skin induces alopecia and epidermal hyperplasia", "quote": "(Lce1 and Lce3) or hornerin (Hrnr) (Fig. 5a and Table S2). Interestingly, multiple genes, including transcription factors, that control hair follicle differentiation (e.g. Msx2, Bmp2, Bmp4, Foxn1, Efl5, Hoxc13 and Lhx2) were found downregulated in the skin of K5-Myb mice (Figs. 5a and Table S2). Qua", "n_hits": 4 }, { "paper": "Alopecia in a Viable Phospholipase C Delta 1 and Phospholipase C Delta 3 Double Mutant", "quote": "and Hoxc13, showed unaltered expression between wild-type and oltSH and oltNH mutants. The expression levels of genes encoding for secreted signalling proteins Pdgfa, Pdgfb, Shh, Bmp2 and Bmp4 were also unchanged (Figure 10) [75–81]. However, Krtap12-1 (in the hair cuticle) and Crisp1 (in the hair m", "n_hits": 3 } ], "grounded_in_corpus": true }, { "gene": "BMP4", "name": "Bone morphogenetic protein 4", "diseases": [ "AGA", "CIA" ], "pathway": "BMP/TGFβ", "twin_node": "BMP", "effect": "+", "role": "modulator", "drugs": [ "BMP antagonists (investigational)", "noggin(antagonist)" ], "mechanism": "telogen 유지·HFSC 정지 신호(생리적 catagen/telogen 조절); Wnt 와 길항.", "evidence_paper_ids": [], "n_evidence": 0, "mention_count": 0, "sources": [ "discover:AGA", "discover:CIA", "seed" ], "in_model": true, "uncertain": false, "structure": { "accession": "P12644", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/P12644", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-P12644-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-P12644-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/P12644", "mean_plddt": 78.5, "plddt_band": "Confident (70–90)", "n_residues": 408, "local_pdb": "digital_twin\\data\\structures\\P12644_AF.pdb" }, "uniprot": "P12644", "uniprot_name": "Bone morphogenetic protein 4", "length": 408, "function": "Growth factor of the TGF-beta superfamily that plays essential roles in many developmental processes, including neurogenesis, vascular development, angiogenesis and osteogenesis (PubMed:31363885). Acts in concert with PTHLH/PTHRP to stimulate ductal outgrowth during embryonic mammary development and to inhibit hair follicle induction (By similarity). Initiates the canonical BMP signaling cascade by associating with type I receptor BMPR1A and type II receptor BMPR2 (PubMed:25868050, PubMed:8006002). Once all three components are bound together in a complex at the cell surface, BMPR2 phosphoryla", "pdb_count": 0, "pdb_ids": [], "grounding": [ { "paper": "‘Cyclic alopecia’ in Msx2 mutants defects in hair cycling and hair shaft differentiation", "quote": "uring the hair cycle, Msx2 deficiency shortens anagen phase, but prolongs catagen and telogen. Msx2-deficient hair shafts are structurally abnormal. Molecular analyses suggest a Bmp4/Bmp2/Msx2/Foxn1 acidic hair keratin pathway is involved. These structurally abnormal hairs are easily dislodged in ca", "n_hits": 10 }, { "paper": "Secretory phospholipase A2-IIA overexpressing mice exhibit cyclic alopecia mediated through aberrant hair shaft differentiation and impaired wound healing response", "quote": "ecursor cells in K14-sPLA2-IIA homozygous mice (Fig. 4d). To understand the molecular mech- anisms underlying impaired differentiation of the matrix cells, we checked the level of BMP4, Shh and Lef1, which are known to regulate the matrix cells proliferation and generation of precursors for IRS and ", "n_hits": 7 }, { "paper": "Overexpression of MYB in the skin induces alopecia and epidermal hyperplasia", "quote": "and Lce3) or hornerin (Hrnr) (Fig. 5a and Table S2). Interestingly, multiple genes, including transcription factors, that control hair follicle differentiation (e.g. Msx2, Bmp2, Bmp4, Foxn1, Efl5, Hoxc13 and Lhx2) were found downregulated in the skin of K5-Myb mice (Figs. 5a and Table S2). Quantitat", "n_hits": 4 }, { "paper": "Alopecia in a Viable Phospholipase C Delta 1 and Phospholipase C Delta 3 Double Mutant", "quote": "13, showed unaltered expression between wild-type and oltSH and oltNH mutants. The expression levels of genes encoding for secreted signalling proteins Pdgfa, Pdgfb, Shh, Bmp2 and Bmp4 were also unchanged (Figure 10) [75–81]. However, Krtap12-1 (in the hair cuticle) and Crisp1 (in the hair medulla) ", "n_hits": 3 } ], "grounded_in_corpus": true }, { "gene": "BRD4", "name": "Bromodomain-containing protein 4", "diseases": [ "AGA" ], "pathway": "Epigenetic", "twin_node": "HFSC", "effect": "+", "role": "modulator", "drugs": [ "BET inhibitor", "Birabresib", "JQ1 (tool)", "Molibresib" ], "mechanism": "HFSC 운명 조절(예상외 표현형).", "evidence_paper_ids": [], "n_evidence": 0, "mention_count": 0, "sources": [ "discover:HFSC", "seed" ], "in_model": true, "uncertain": false, "structure": { "accession": "O60885", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/O60885", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-O60885-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-O60885-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/O60885", "mean_plddt": 55.3, "plddt_band": "Low (50–70)", "n_residues": 1362, "local_pdb": "digital_twin\\data\\structures\\O60885_AF.pdb" }, "uniprot": "O60885", "uniprot_name": "Bromodomain-containing protein 4", "length": 1362, "function": "Chromatin reader protein that recognizes and binds acetylated histones and plays a key role in transmission of epigenetic memory across cell divisions and transcription regulation (PubMed:20871596, PubMed:23086925, PubMed:23317504, PubMed:29176719, PubMed:29379197). Remains associated with acetylated chromatin throughout the entire cell cycle and provides epigenetic memory for postmitotic G1 gene transcription by preserving acetylated chromatin status and maintaining high-order chromatin structure (PubMed:22334664, PubMed:23317504, PubMed:23589332). During interphase, plays a key role in regul", "pdb_count": 599, "pdb_ids": [ "2I8N", "2LSP", "2MJV", "2N3K", "2NCZ", "2ND0", "2ND1", "2NNU" ], "grounding": [ { "paper": "Ox40-Cre–mediated deletion of BRD4 reveals an unexpected phenotype of hair follicle stem cells in alopecia", "quote": "d: October 13, 2022 Published: December 8, 2022 Reference information: JCI Insight. 2022;7(23):e164534. https://doi.org/10.1172/jci. insight.164534. Ox40-Cre–mediated deletion of BRD4 reveals an unexpected phenotype of hair follicle stem cells in alopecia Mou Wen,1,2 Yuanlin Ying,1 Xiang Xiao,1 Pres", "n_hits": 84 }, { "paper": "2,5-Diazabicyclo[2.2.1]heptane in medicinal chemistry a treasure trove of therapeutic opportunities.", "quote": "interaction with 5-HT1A suggests a degree of selectivity toward 5-HT7 within the limited receptor panel evaluated.172 In 2016, Gerstenberger et al. designed several modulators of bromodomain with compounds housing the 2,5-DBH moiety.181 The ability of bromodomains to specifically identify ε-N-lysine", "n_hits": 7 } ], "grounded_in_corpus": true }, { "gene": "CDK4", "name": "Cyclin-dependent kinase 4", "diseases": [ "CIA" ], "pathway": "Cell-cycle/apoptosis", "twin_node": "APO", "effect": "+", "role": "modulator", "drugs": [ "Abemaciclib", "Palbociclib", "Ribociclib", "palbociclib(CDK4/6i)" ], "mechanism": "모기질 증식(G1→S) 구동 → 화학요법 감수성↑; 억제 시 G1 정지로 taxane 탈모 보호.", "evidence_paper_ids": [], "n_evidence": 0, "mention_count": 0, "sources": [ "discover:CIA", "seed" ], "in_model": true, "uncertain": false, "structure": { "accession": "P11802", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/P11802", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-P11802-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-P11802-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/P11802", "mean_plddt": 86.8, "plddt_band": "Confident (70–90)", "n_residues": 303, "local_pdb": "digital_twin\\data\\structures\\P11802_AF.pdb" }, "uniprot": "P11802", "uniprot_name": "Cyclin-dependent kinase 4", "length": 303, "function": "Ser/Thr-kinase component of cyclin D-CDK4 (DC) complexes that phosphorylate and inhibit members of the retinoblastoma (RB) protein family including RB1 and regulate the cell-cycle during G(1)/S transition. Phosphorylation of RB1 allows dissociation of the transcription factor E2F from the RB/E2F complexes and the subsequent transcription of E2F target genes which are responsible for the progression through the G(1) phase. Hypophosphorylates RB1 in early G(1) phase. Cyclin D-CDK4 complexes are major integrators of various mitogenenic and antimitogenic signals. Also phosphorylates SMAD3 in a cel", "pdb_count": 15, "pdb_ids": [ "2W96", "2W99", "2W9F", "2W9Z", "3G33", "5FWK", "5FWL", "5FWM" ], "grounding": [ { "paper": "CDK4 6 inhibition mitigates stem cell damage in a novel model for taxane‐induced alopecia", "quote": "Article CDK4/6 inhibition mitigates stem cell damage in a novel model for taxane-induced alopecia Talveen S Purba1,* , Kayumba Ng’andu1, Lars Brunken2, Eleanor Smart1 , Ellen Mitchell1, Nashat", "n_hits": 60 }, { "paper": "ISEV2025 Abstract Book.", "quote": "ase with elevated EVs in the serum of patients. One crucial regulator and prognostic biomarker for AML is the cell cycle regulator cyclin-dependent kinase 6 (CDK6). Palbociclib, a CDK4/6 kinase inhibitor, is already FDA-approved for breast cancer and in clinical trials for AML; however, the exact me", "n_hits": 10 }, { "paper": "2,5-Diazabicyclo[2.2.1]heptane in medicinal chemistry a treasure trove of therapeutic opportunities.", "quote": ", DCM, 25 °C, 3 h. RSC Medicinal Chemistry Review RSC Med. Chem. This journal is © The Royal Society of Chemistry 2026 Xu et al. discovered a series of pyrimidine-indazole- based CDK4 inhibitors by taking reference from the FDA- approved CDK4/6 inhibitors abemaciclib. The aim was to design inhibitor", "n_hits": 8 }, { "paper": "Restoration of follicular β-catenin signaling by mesenchymal stem cells promotes hair growth in mice with androgenetic alopecia", "quote": "A​GAA​CAA​GC CCT​TGT​TTA​GCC​AGA​GGC​CG Ccna1 (mouse) ACC​GTG​CTA​GGG​GTG​TTG​A CGT​TTG​GCT​GGT​TCA​TTG​ACC​ Cdk2 (mouse) GCG​ACC​TCC​TCC​CAA​TAT​CG GTC​TGA​TCT​CTT​TCC​CCA​ACTCT​ Cdk4 (mouse) CTG​AAC​CGC​TTT​GGC​AAG​AC GCC​CTC​TCT​TAT​CGC​CAG​AT β-catenin (mouse) GTT​CGC​CTT​CAT​TAT​GGA​CTGCC​ ATA​", "n_hits": 3 } ], "grounded_in_corpus": true }, { "gene": "CDK6", "name": "Cyclin-dependent kinase 6", "diseases": [ "CIA" ], "pathway": "Cell-cycle/apoptosis", "twin_node": "APO", "effect": "+", "role": "modulator", "drugs": [ "Abemaciclib", "Palbociclib", "Ribociclib", "palbociclib", "ribociclib", "trilaciclib (concept for CIA)" ], "mechanism": "모기질 증식 구동; CDK4/6 억제 시 정지보호 효과 공유.", "evidence_paper_ids": [], "n_evidence": 0, "mention_count": 0, "sources": [ "discover:CIA", "discover:recent", "seed" ], "in_model": true, "uncertain": false, "structure": { "accession": "Q00534", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/Q00534", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-Q00534-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-Q00534-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/Q00534", "mean_plddt": 85.4, "plddt_band": "Confident (70–90)", "n_residues": 326, "local_pdb": "digital_twin\\data\\structures\\Q00534_AF.pdb" }, "uniprot": "Q00534", "uniprot_name": "Cyclin-dependent kinase 6", "length": 326, "function": "Serine/threonine-protein kinase involved in the control of the cell cycle and differentiation; promotes G1/S transition. Phosphorylates pRB/RB1 and NPM1. Interacts with D-type G1 cyclins during interphase at G1 to form a pRB/RB1 kinase and controls the entrance into the cell cycle. Involved in initiation and maintenance of cell cycle exit during cell differentiation; prevents cell proliferation and negatively regulates cell differentiation, but is required for the proliferation of specific cell types (e.g. erythroid and hematopoietic cells). Essential for cell proliferation within the dentate ", "pdb_count": 20, "pdb_ids": [ "1BI7", "1BI8", "1BLX", "1G3N", "1JOW", "1XO2", "2EUF", "2F2C" ], "grounding": [ { "paper": "ISEV2025 Abstract Book.", "quote": "in CRT-EVs compared to other sources, indicating its potential as a specific biomarker of OA. Funding: This research was supported by the APVV-17-0118 and VEGA 1/0146/24. PS2.756 CDK6 regulates extracellular vesicles in AML Belinda S. Maw1*, Elisabeth Gamper1*, Nathalie Havranek1, Astrid Digruber2, ", "n_hits": 10 }, { "paper": "2,5-Diazabicyclo[2.2.1]heptane in medicinal chemistry a treasure trove of therapeutic opportunities.", "quote": "e-indazole- based CDK4 inhibitors by taking reference from the FDA- approved CDK4/6 inhibitors abemaciclib. The aim was to design inhibitors with greater selectivity for CDK4 over CDK6, achieving higher specificity in both enzymatic and cellular target engagement assays.103 Cyclin-dependent kinases ", "n_hits": 4 }, { "paper": "Extracellular vesicles in age-related diseases disease pathogenesis, intervention, and biomarker.", "quote": "K-EVs and successfully suppressed pancreatic cancer cell pro- liferation [237, 238]. Bioinformatics analysis using miR- Walk identified several let-7b-5p target genes, including CDK6, CCNA2, and AURKB etc., all of which are impli- cated in cancer progression. Among these, CDK6 was significantly down", "n_hits": 3 } ], "grounded_in_corpus": true }, { "gene": "CRH", "name": "Corticotropin-releasing factor", "diseases": [ "AGA", "Other" ], "pathway": "Stress/HPA", "twin_node": "APO", "effect": "+", "role": "driver", "drugs": [ "Antalarmin (CRHR1 antagonist, experimental)", "astressin-B(antagonist)" ], "mechanism": "스트레스 호르몬; PTEN 억제→DP apoptosis (CRF 과발현 탈모).", "evidence_paper_ids": [], "n_evidence": 0, "mention_count": 0, "sources": [ "discover:HFSC", "seed" ], "in_model": true, "uncertain": false, "structure": { "accession": "P06850", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/P06850", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-P06850-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-P06850-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/P06850", "mean_plddt": 62.0, "plddt_band": "Low (50–70)", "n_residues": 196, "local_pdb": "digital_twin\\data\\structures\\P06850_AF.pdb" }, "uniprot": "P06850", "uniprot_name": "Corticoliberin", "length": 196, "function": "Hormone regulating the release of corticotropin from pituitary gland (By similarity). Induces NLRP6 in intestinal epithelial cells, hence may influence gut microbiota profile (By similarity)", "pdb_count": 5, "pdb_ids": [ "1GO9", "1GOE", "3EHT", "3EHU", "6P9X" ], "grounding": [ { "paper": "Corticotropin-releasing hormone inhibits autophagy by suppressing PTEN to promote apoptosis in dermal papilla cells", "quote": "Research Article Annals of Medicine 2025, VOL. 57, NO. 1, 2490823 Corticotropin-releasing hormone inhibits autophagy by suppressing PTEN to promote apoptosis in dermal papilla cells Wenzi Lianga, Xiuwen Chenb, Na Nic, Chutong Zhuangc, Zhiying Yua, Ziqing Xua, Yingshi", "n_hits": 175 }, { "paper": "CRF Receptor Antagonist Astressin-B Reverses and Prevents Alopecia in CRF Over-Expressing Mice", "quote": "lifornia, United States of America, 4 Department of Molecular Microbiology and Immunology, Oregon Health & Sciences University, Portland, Oregon, United States of America Abstract Corticotropin-releasing factor (CRF) signaling pathways are involved in the stress response, and there is growing eviden", "n_hits": 148 }, { "paper": "Research on the effects and preliminary mechanism of action of Shaoyao Gancao granule (芍药甘草颗粒) on hypothalamic-pituitary-adrenal axis and T lymphocytes in stressed alopecia areata mice", "quote": "larmin, and compound glycyrrhizin (CG). On day 24, overall and trichoscopic photographs of mice were taken on day 24 of the experiment; behavioral tests were completed; serum corticotropin-releasing hormone (CRH), adrenocorticotropic hormone (ACTH), and cortisol levels were measured by enzyme-linked", "n_hits": 24 }, { "paper": "Clinical Practice Guidelines for Menopause An Executive Summary and Recommendations Indian Menopause Society 2026.", "quote": "upplementation. Table 3: Treatment recommendation based on bone mineral density/fracture risk assessment tool/osteoporosis self‑assessment tool for Asians BMD Fracture risk BMD + CRF/ CRF by FRAX and or OSTA Treatment decision Choice of therapy Low bone mass Low TLM/reassess after 5 years TLM Low bo", "n_hits": 3 } ], "grounded_in_corpus": true }, { "gene": "CTLA4", "name": "Cytotoxic T-lymphocyte protein 4", "diseases": [ "AA" ], "pathway": "Immune tolerance", "twin_node": "INF", "effect": "-", "role": "protector", "drugs": [ "abatacept", "abatacept (CTLA4-Ig, investigational in AA)" ], "mechanism": "T세포 체크포인트; AA 감수성 유전자.", "evidence_paper_ids": [], "n_evidence": 0, "mention_count": 0, "sources": [ "discover:AA", "seed" ], "in_model": true, "uncertain": false, "structure": { "accession": "P16410", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/P16410", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-P16410-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-P16410-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/P16410", "mean_plddt": 80.1, "plddt_band": "Confident (70–90)", "n_residues": 223, "local_pdb": "digital_twin\\data\\structures\\P16410_AF.pdb" }, "uniprot": "P16410", "uniprot_name": "Cytotoxic T-lymphocyte protein 4", "length": 223, "function": "Inhibitory receptor acting as a major negative regulator of T-cell responses (PubMed:11279501, PubMed:11279502, PubMed:16551244, PubMed:1714933, PubMed:18641304, PubMed:28484017). Acts as a decoy receptor: the affinity of CTLA4 for its natural B7 family ligands, CD80 and CD86, is considerably stronger than the affinity of their cognate stimulatory coreceptor CD28 (PubMed:11279501, PubMed:11279502, PubMed:16551244, PubMed:1714933, PubMed:28484017)", "pdb_count": 22, "pdb_ids": [ "1AH1", "1H6E", "1I85", "1I8L", "2X44", "3BX7", "3OSK", "5GGV" ], "grounding": [ { "paper": "Skin cancer understanding the journey of transformation from conventional to advanced treatment approaches.", "quote": "cSSC cutaneous squamous cell carcinoma, PD1 Program Death 1, EGFR Epidermal growth factor receptor, NSCLC Non-small cell lung cancer, HNSCC Head and neck squamous cell carcinoma, CTLA-4 Cytotoxic t-lymphocyte associated protein-4 Treatment options Description Manifestation Approved Reference Convent", "n_hits": 9 }, { "paper": "Gene Array Profiling and Immunomodulation Studies Define a Cell-Mediated Immune Response Underlying the Pathogenesis of Alopecia Areata in a Mouse Model and Humans", "quote": "ia areata pathogenesis and suggested targeting antigen-pre- senting cells and reactive lymphocytes may be effect- ive in alopecia areata treatment. Key words: autoimmune/B7.1/B7.2/CTLA-4-mIgG2am/lymphocyte costimulation/rodent model. J Invest Dermatol 119:392± 402, 2002 A lopecia areata (AA) in huma", "n_hits": 6 }, { "paper": "Selective Expansion of Tregs Using the IL-2 Cytokine Antibody Complex Does Not Reverse Established Alopecia Areata in C3H HeJ Mice", "quote": "e with AA, NKG2D- expressing CD8 T cells widely infiltrate both haired and hairless skin areas, which have tissue-resident memory T-cell phenotypes. Tregs in the skin express CD25, CTLA-4, GATA-3, and Jagged1 and efficiently proliferate with IL-2 cytokine antibody complex. However, expanding Tregs in ", "n_hits": 5 }, { "paper": "SOCS3 treatment prevents the development of alopecia areata by inhibiting CD8+ T cell-mediated autoimmune destruction", "quote": "10 through modulating STAT3 activation [23]. Yuet al demonstrated that SOCS3 deletion in T lymphocytes suppresses development of chronic ocular inflammation via upregulation of CTLA-4 and expansion of regulatory T cells. SOCS3 interacts with CTLA-4 and negatively regulates CTLA-4 levels in T cells, ", "n_hits": 4 } ], "grounded_in_corpus": true }, { "gene": "CXCL10", "name": "C-X-C motif chemokine 10 (IP-10)", "diseases": [ "AA" ], "pathway": "JAK-STAT", "twin_node": "INF", "effect": "+", "role": "driver", "drugs": [], "mechanism": "STAT1 유도 T세포 유인 케모카인.", "evidence_paper_ids": [], "n_evidence": 0, "mention_count": 0, "sources": [ "discover:AA", "seed" ], "in_model": true, "uncertain": false, "structure": { "accession": "P02778", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/P02778", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-P02778-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-P02778-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/P02778", "mean_plddt": 89.5, "plddt_band": "Confident (70–90)", "n_residues": 98, "local_pdb": "digital_twin\\data\\structures\\P02778_AF.pdb" }, "uniprot": "P02778", "uniprot_name": "C-X-C motif chemokine 10", "length": 98, "function": "Pro-inflammatory cytokine that is involved in a wide variety of processes such as chemotaxis, differentiation, and activation of peripheral immune cells, regulation of cell growth, apoptosis and modulation of angiostatic effects (PubMed:11157474, PubMed:22652417, PubMed:7540647). Plays thereby an important role during viral infections by stimulating the activation and migration of immune cells to the infected sites (By similarity). Mechanistically, binding of CXCL10 to the CXCR3 receptor activates G protein-mediated signaling and results in downstream activation of phospholipase C-dependent pa", "pdb_count": 5, "pdb_ids": [ "1LV9", "1O7Y", "1O7Z", "1O80", "8K2X" ], "grounding": [ { "paper": "CXCR3 Blockade Inhibits T-cell Migration into the Skin and Prevents Development of Alopecia Areata", "quote": "o involved in a wide range of disease processes, including infection, autoimmune, inflammatory, and malignant diseases (12–14). The CXCR3 receptor and its cognate ligands, CXCL9, CXCL10 and CXCL11 have been implicated in directing a Th1 inflammatory response (15–18). Recent studies support the notio", "n_hits": 67 }, { "paper": "Modulating immune responses in alopecia therapeutic insights and potential targets of antisense oligonucleotides", "quote": "ized by sudden hair loss, with interferon-gamma (IFN-γ) playing a pivotal role in pathogenesis. The upregulation of IFN response genes, including IFN-inducible chemokines CXCL9, CXCL10, and CXCL11, in lesional skin reflects the activation of the IFN response pathway and contributes to immune cell re", "n_hits": 14 }, { "paper": "Induction of alopecia areata in C3H HeJ mice using polyinosinic-polycytidylic acid (poly[IC]) and interferon-gamma", "quote": "the AA lesions revealed increased infiltration of CD4+ and CD8+ cells infiltration around the hair follicles. IFNγ and poly(I:C) increased the expression of NLRP3, IL-1β, CXCL9, CXCL10, and CXCL11 in mouse skin. Taken together, these findings indicate a shorter and more convenient means of AA animal", "n_hits": 8 }, { "paper": "ISEV2025 Abstract Book.", "quote": "itochon- drial fragmentation, fostering a more interconnected mitochon- drial network. Notably, they also significantly lowered the levels of key inflammatory mediators, including CXCL10, IL-18, and IL-4. Summary/Conclusion: These findings highlight PDNVs as potential modulators of mitochondrial dyn", "n_hits": 7 } ], "grounded_in_corpus": true }, { "gene": "CXCL12", "name": "Stromal cell-derived factor 1 (SDF-1)", "diseases": [ "AA", "AGA" ], "pathway": "Chemokine", "twin_node": "INF", "effect": "+", "role": "driver", "drugs": [ "AMD3100", "Plerixafor (CXCR4 antagonist)", "anti-CXCL12" ], "mechanism": "섬유면역 리모델링·모낭 주변 fibrosis; 중화 시 발모.", "evidence_paper_ids": [], "n_evidence": 0, "mention_count": 0, "sources": [ "discover:AA", "discover:HFSC", "seed" ], "in_model": true, "uncertain": false, "structure": { "accession": "P48061", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/P48061", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-P48061-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-P48061-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/P48061", "mean_plddt": 83.3, "plddt_band": "Confident (70–90)", "n_residues": 93, "local_pdb": "digital_twin\\data\\structures\\P48061_AF.pdb" }, "uniprot": "P48061", "uniprot_name": "Stromal cell-derived factor 1", "length": 93, "function": "Chemoattractant active on T-lymphocytes and monocytes but not neutrophils (PubMed:18802065, PubMed:39093700). Activates the C-X-C chemokine receptor CXCR4 to induce a rapid and transient rise in the level of intracellular calcium ions and chemotaxis (PubMed:8752281, PubMed:18802065, PubMed:39093700). Also binds to atypical chemokine receptor ACKR3, which activates the beta-arrestin pathway and acts as a scavenger receptor for CXCL12/SDF-1 (PubMed:16107333, PubMed:19255243). Binds to the allosteric site (site 2) of integrins and activates integrins ITGAV:ITGB3, ITGA4:ITGB1 and ITGA5:ITGB1 in a ", "pdb_count": 30, "pdb_ids": [ "1A15", "1QG7", "1SDF", "1VMC", "2J7Z", "2K01", "2K03", "2K04" ], "grounding": [ { "paper": "CXCL12 Neutralizing Antibody Promotes Hair Growth in Androgenic Alopecia and Alopecia Areata", "quote": "Citation: Zheng, M.; Kim, M.-H.; Park, S.-G.; Kim, W.-S.; Oh, S.-H.; Sung, J.-H. CXCL12 Neutralizing Antibody Promotes Hair Growth in Androgenic Alopecia and Alopecia Areata. Int. J. Mol. Sci. 2024, 25, 1705. https://doi.org/10.3390/ ijms25031705 Academic Editor: Paw", "n_hits": 200 }, { "paper": "Impact of SDF-1 and AMD3100 on Hair Follicle Dynamics in a Chronic Stress Model", "quote": "Karri, S.S.; Andersen, B. The circadian clock and diseases of the skin. FEBS Lett. 2021, 595, 2413–2436. [CrossRef] 9. Cambier, S.; Gouwy, M.; Proost, P. The chemokines CXCL8 and CXCL12: Molecular and functional properties, role in disease and efforts towards pharmacological intervention. Cell. Mol.", "n_hits": 155 }, { "paper": "CXCL12 Drives Reversible Fibroimmune Remodeling in Androgenetic Alopecia Revealed by Single-Cell RNA Sequencing", "quote": "Gabbiani Received: 17 June 2025 Revised: 4 July 2025 Accepted: 7 July 2025 Published: 8 July 2025 Citation: An, S.; Zheng, M.; Park, I.G.; Song, L.; Kim, J.; Noh, M.; Sung, J.-H. CXCL12 Drives Reversible Fibroimmune Remodeling in Androgenetic Alopecia Revealed by Single-Cell RNA Sequencing. Int. J. ", "n_hits": 112 }, { "paper": "ISEV2025 Abstract Book.", "quote": "e addressed, they could be considered a promising tool for the direct delivery of therapeutic cargoes to tumours. Funding: University of Milan and McGill University PS2.899 CTHRC1+CXCL12+ fibroblasts-epithelia communication via exosome foster MDMs accumulation and aggravate lung injury Presenter: Ch", "n_hits": 9 } ], "grounded_in_corpus": true }, { "gene": "CXCR3", "name": "C-X-C chemokine receptor type 3", "diseases": [ "AA" ], "pathway": "Chemokine", "twin_node": "INF", "effect": "+", "role": "driver", "drugs": [ "CXCR3 antagonist", "CXCR3 antagonists (preclinical)" ], "mechanism": "T세포 피부 침윤 수용체; 차단 시 AA 예방.", "evidence_paper_ids": [], "n_evidence": 0, "mention_count": 0, "sources": [ "discover:AA", "seed" ], "in_model": true, "uncertain": false, "structure": { "accession": "P49682", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/P49682", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-P49682-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-P49682-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/P49682", "mean_plddt": 80.5, "plddt_band": "Confident (70–90)", "n_residues": 368, "local_pdb": "digital_twin\\data\\structures\\P49682_AF.pdb" }, "uniprot": "P49682", "uniprot_name": "C-X-C chemokine receptor type 3", "length": 368, "function": "Receptor for the C-X-C chemokine CXCL9, CXCL10 and CXCL11 and mediates the proliferation, survival and angiogenic activity of human mesangial cells (HMC) through a heterotrimeric G-protein signaling pathway (PubMed:12782716). Binds to CCL21. Probably promotes cell chemotaxis response. Upon activation by PF4, induces activated T-lymphocytes migration mediated via downstream Ras/extracellular signal-regulated kinase (ERK) signaling", "pdb_count": 12, "pdb_ids": [ "8HNK", "8HNL", "8HNM", "8HNN", "8K2W", "8K2X", "8XXY", "8XXZ" ], "grounding": [ { "paper": "CXCR3 Blockade Inhibits T-cell Migration into the Skin and Prevents Development of Alopecia Areata", "quote": "CXCR3 Blockade Inhibits T-cell Migration into the Skin and Prevents Development of Alopecia Areata Zhenpeng Dai*, Luzhou Xing‖, Jane Cerise*, Eddy Hsi Chun Wang*, Ali Jabbari*, Annemie", "n_hits": 179 }, { "paper": "Immunoregulatory Effects of Myeloid-Derived Suppressor Cell Exosomes in Mouse Model of Autoimmune Alopecia Areata", "quote": "ion did not differ between the two MDSC preparations (Figure 1C). Myeloid-derived suppressor cells migrate from the BM toward inflamed organs, which involves predominantly CCR7, CXCR3, and CXCR4. Chemokine receptor expression differed between ex vivo sorted and culture-derived MDSC with CCR5, CCR7, ", "n_hits": 4 }, { "paper": "Blockade of IL-7 signaling suppresses inflammatory responses and reverses alopecia areata in C3H HeJ mice", "quote": "orts in other mouse models (20, 21), IL-7c increased the total number of lymphocytes in lymphoid organs (fig. S3A). We also found that IL-7c robustly increased the frequency of CXCR3+CD8+ T cells, T-bet+CD8+ T cells, and IFN-–producing CD8+ T cells in SDLNs (Fig. 2I and fig. S3B) but only slightly ", "n_hits": 3 }, { "paper": "Selective inhibition of JAK3 signaling is sufficient to reverse alopecia areata", "quote": "rimers. 2017;3:17011. 4. Xing L, et al. Alopecia areata is driven by cytotoxic T lymphocytes and is reversed by JAK inhibition. Nat Med. 2014;20(9):1043–1049. 5. Dai Z, et al. CXCR3 blockade inhibits T cell migration into the skin and prevents development of alopecia areata. J Immunol. 2016;197(4):1", "n_hits": 3 } ], "grounded_in_corpus": true }, { "gene": "CXCR4", "name": "C-X-C chemokine receptor type 4", "diseases": [ "AA", "AGA" ], "pathway": "Chemokine", "twin_node": "INF", "effect": "+", "role": "modulator", "drugs": [ "AMD3100(plerixafor)", "plerixafor (CXCR4 antagonist, not AA-specific)" ], "mechanism": "CXCL12 수용체.", "evidence_paper_ids": [], "n_evidence": 0, "mention_count": 0, "sources": [ "discover:AA", "seed" ], "in_model": true, "uncertain": false, "structure": { "accession": "P61073", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/P61073", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-P61073-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-P61073-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/P61073", "mean_plddt": 82.3, "plddt_band": "Confident (70–90)", "n_residues": 352, "local_pdb": "digital_twin\\data\\structures\\P61073_AF.pdb" }, "uniprot": "P61073", "uniprot_name": "C-X-C chemokine receptor type 4", "length": 352, "function": "Receptor for the C-X-C chemokine CXCL12/SDF-1 that transduces a signal by increasing intracellular calcium ion levels and enhancing MAPK1/MAPK3 activation (PubMed:10074102, PubMed:10452968, PubMed:10644702, PubMed:10825158, PubMed:18799424, PubMed:20048153, PubMed:20505072, PubMed:24912431, PubMed:28978524, PubMed:8752280, PubMed:8752281). Ligand binding causes a conformation change that triggers signaling via guanine nucleotide-binding proteins (G proteins) and modulates the activity of downstream effectors, such as adenylate cyclase (PubMed:16725153, PubMed:17197449, PubMed:18799424, PubMed:", "pdb_count": 30, "pdb_ids": [ "2K03", "2K04", "2K05", "2N55", "3ODU", "3OE0", "3OE6", "3OE8" ], "grounding": [ { "paper": "Impact of SDF-1 and AMD3100 on Hair Follicle Dynamics in a Chronic Stress Model", "quote": "ronic stress is a common cause of hair loss, involving inflammatory responses and changes in cellular signaling pathways. This study explores the mechanism of action of the SDF- 1/CXCR4 signaling axis in chronic stress-induced hair loss. The research indicates that SDF-1 pro- motes hair follicle gro", "n_hits": 115 }, { "paper": "CXCL12 Drives Reversible Fibroimmune Remodeling in Androgenetic Alopecia Revealed by Single-Cell RNA Sequencing", "quote": "on driving CXCL12 expression. Autocrine CXCL12-ACKR3 signaling in DFs activated TGF-β pathways and promoted fibrotic extracellular matrix deposition. In parallel, paracrine CXCL12-CXCR4 signaling reprogrammed Sox2+Twist1+ dermal papilla cells (DPCs) and promoted the accumulation of pro-fibrotic Trem", "n_hits": 32 }, { "paper": "CXCL12 Neutralizing Antibody Promotes Hair Growth in Androgenic Alopecia and Alopecia Areata", "quote": "ns increased the secretion of CXCL12 from DFs through the androgen receptor (AR). Secreted CXCL12 from DFs increased the expression of the AR and C-X-C Motif Chemokine Receptor 4 (CXCR4) in dermal papilla cells (DPCs), which induced hair loss in AGA. Likewise, CXCL12 expression is increased in AA mi", "n_hits": 28 }, { "paper": "ISEV2025 Abstract Book.", "quote": "variation in terms of surface markers and expression of miR-29 and miR-126, previously detected also in PLTs. LCEP-EVs induced endothelial activation (upregulation of CXCL1, CCL2, CXCR4 and VCAM1) and enhanced neutrophil adhesion and migration compared to HDEP-EVs, without affecting angiogene- sis. ", "n_hits": 14 } ], "grounded_in_corpus": true }, { "gene": "DNMT1", "name": "DNA (cytosine-5)-methyltransferase 1", "diseases": [ "AGA" ], "pathway": "Epigenetic", "twin_node": "HFSC", "effect": "+", "role": "modulator", "drugs": [ "Azacitidine", "Decitabine" ], "mechanism": "HFSC 활성화 확률 유지; 결핍 시 진행성 탈모.", "evidence_paper_ids": [], "n_evidence": 0, "mention_count": 0, "sources": [ "discover:HFSC", "seed" ], "in_model": true, "uncertain": false, "structure": { "accession": "P26358", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/P26358", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-P26358-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-P26358-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/P26358", "mean_plddt": 77.8, "plddt_band": "Confident (70–90)", "n_residues": 1616, "local_pdb": "digital_twin\\data\\structures\\P26358_AF.pdb" }, "uniprot": "P26358", "uniprot_name": "DNA (cytosine-5)-methyltransferase 1", "length": 1616, "function": "DNA methyltransferase that methylates CpG residues (PubMed:17200670, PubMed:18754681, PubMed:21745816, PubMed:26070743). Preferentially methylates hemimethylated DNA (PubMed:21745816, PubMed:26070743). Associates with DNA replication sites in S phase maintaining the methylation pattern in the newly synthesized strand, that is essential for epigenetic inheritance (PubMed:17200670, PubMed:21745816). Associates with chromatin during G2 and M phases to maintain DNA methylation independently of replication (PubMed:21745816). It is responsible for maintaining methylation patterns established in deve", "pdb_count": 25, "pdb_ids": [ "3EPZ", "3PTA", "3SWR", "4WXX", "4YOC", "4Z96", "4Z97", "5WVO" ], "grounding": [ { "paper": "Progressive alopecia reveals decreasing stem cell activation probability during aging of mice with epidermal deletion of DNA methyltransferase 1 (DNMT1)", "quote": "Progressive alopecia reveals decreasing stem cell activation probability during aging of mice with epidermal deletion of DNA methyltransferase 1 (DNMT1) Ji Li1,2, Ting-Xin Jiang1, Michael W. Hughes1, Ping Wu1, Randall B Widelitz1, Guoping Fan3, and Cheng-Ming Chuong1,* 1Department of Pathology, Keck", "n_hits": 67 }, { "paper": "Modified Huanjingjian Prevents Chemotherapy-Induced Alopecia by Inhibiting Genomic DNA Methylation of the Wnt Signaling Pathway in Mice", "quote": "ated in AGA.33 The global DNA hypermethylation of the peripheral blood monocytes in patients with alopecia was observed, and the transcription level of DNA methyl­ transferase 1 (DNMT1) significantly increased.34 As for DNMT1, evidence shows that it plays an important role in the renewal and differe", "n_hits": 9 } ], "grounded_in_corpus": true }, { "gene": "FGF5", "name": "Fibroblast growth factor 5", "diseases": [ "CIA", "Other" ], "pathway": "Growth factor", "twin_node": "BMP", "effect": "+", "role": "modulator", "drugs": [ "Anti-FGF5 cosmetics (unproven)", "FGF5 inhibitor" ], "mechanism": "anagen 종료→catagen 진입 신호(catagen brake 축); 억제 시 모발 연장.", "evidence_paper_ids": [], "n_evidence": 0, "mention_count": 0, "sources": [ "discover:CIA", "seed" ], "in_model": true, "uncertain": false, "structure": { "accession": "P12034", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/P12034", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-P12034-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-P12034-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/P12034", "mean_plddt": 75.7, "plddt_band": "Confident (70–90)", "n_residues": 268, "local_pdb": "digital_twin\\data\\structures\\P12034_AF.pdb" }, "uniprot": "P12034", "uniprot_name": "Fibroblast growth factor 5", "length": 268, "function": "Plays an important role in the regulation of cell proliferation and cell differentiation. Required for normal regulation of the hair growth cycle. Functions as an inhibitor of hair elongation by promoting progression from anagen, the growth phase of the hair follicle, into catagen the apoptosis-induced regression phase (By similarity)", "pdb_count": 0, "pdb_ids": [], "grounding": [ { "paper": "‘Cyclic alopecia’ in Msx2 mutants defects in hair cycling and hair shaft differentiation", "quote": "entiation, together with concealed skin domains, account for the cyclic alopecia phenotype. Keywords Alopecia; Hair cycle; Hair differentiation; Homeobox genes; Msx2; Foxn1; Ha3; Fgf5; Mouse © 2003 The Company of Biologists Ltd *Authors for correspondence (chuong@pathfinder.usc.edu and maas@rascal.m", "n_hits": 18 }, { "paper": "Overexpression of Bcl-2 Protects from Ultraviolet B-Induced Apoptosis but Promotes Hair Follicle Regression and Chemotherapy-Induced Alopecia", "quote": "A, Fuchs EV, Thompson CB: Manipulation of outer root sheath cell survival perturbs the hair-growth cycle. EMBO J 1999, 18:3596–3603 41. Hebert JM, Rosenquist T, Gotz J, Martin GR: FGF5 as a regulator of the hair growth cycle: evidence from targeted and spontaneous mutations. Cell 1994, 78:1017–1025 ", "n_hits": 8 }, { "paper": "Prostaglandin D2 Inhibits Hair Growth and Is Elevated in Bald Scalp of Men with Androgenetic Alopecia", "quote": "ured the expression of the receptor for PGF2α, which is known for its ability to induce hair growth both in mice (20) and in humans (15). In contrast to the late peak of Ptgds and Fgf5, prostaglandin F receptor (Ptgfr) mRNA peaked in early anagen or late telogen, with a 21-fold change versus second ", "n_hits": 5 }, { "paper": "The Genetic Landscape of Androgenetic Alopecia Current Knowledge and Future Perspectives.", "quote": "including WNT signaling, androgen metabolism, apoptosis, and morphogenesis [11]. This built on an earlier meta-analysis that had expanded candidate loci to implicate genes such as FGF5, IRF4, DKK2, and pathways including melatonin signaling and adipogenesis [12]. Because many participants in these s", "n_hits": 4 } ], "grounded_in_corpus": true }, { "gene": "GAS6", "name": "Growth arrest-specific protein 6", "diseases": [ "AGA", "TelogenEffluvium" ], "pathway": "Growth factor", "twin_node": "DP", "effect": "+", "role": "protector", "drugs": [ "GAS6 gene therapy", "recombinant GAS6 / AXL agonists (preclinical)" ], "mechanism": "모낭 줄기세포 niche 조절.", "evidence_paper_ids": [], "n_evidence": 0, "mention_count": 0, "sources": [ "discover:recent", "seed" ], "in_model": true, "uncertain": false, "structure": { "accession": "Q14393", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/Q14393", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-Q14393-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-Q14393-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/Q14393", "mean_plddt": 85.6, "plddt_band": "Confident (70–90)", "n_residues": 678, "local_pdb": "digital_twin\\data\\structures\\Q14393_AF.pdb" }, "uniprot": "Q14393", "uniprot_name": "Growth arrest-specific protein 6", "length": 678, "function": "Ligand for tyrosine-protein kinase receptors AXL, TYRO3 and MER whose signaling is implicated in cell growth and survival, cell adhesion and cell migration. GAS6/AXL signaling plays a role in various processes such as endothelial cell survival during acidification by preventing apoptosis, optimal cytokine signaling during human natural killer cell development, hepatic regeneration, gonadotropin-releasing hormone neuron survival and migration, platelet activation, or regulation of thrombotic responses", "pdb_count": 4, "pdb_ids": [ "1H30", "2C5D", "4RA0", "5VXZ" ], "grounding": [ { "paper": "Triton modified polyethyleneimine conjugates assembled with growth arrest-specific protein 6 for androgenetic alopecia transdermal gene therapy", "quote": "ceutical Biotechnology, Nanjing University, Nanjing, 210023, Jiangsu, People's Republic of China A R T I C L E I N F O Keywords: Gene therapy Non-viral vector Transdermal delivery Gas6 Hair reproduction Androgenetic alopecia A B S T R A C T Androgenetic alopecia is an androgen-dependent skin disorde", "n_hits": 54 } ], "grounded_in_corpus": true }, { "gene": "GLI1", "name": "Zinc finger protein GLI1", "diseases": [ "AGA", "CIA" ], "pathway": "Hedgehog", "twin_node": "SHH", "effect": "+", "role": "protector", "drugs": [ "Glasdegib", "Sonidegib", "Vismodegib" ], "mechanism": "SHH 하류 전사인자.", "evidence_paper_ids": [], "n_evidence": 0, "mention_count": 0, "sources": [ "discover:CIA", "discover:HFSC", "seed" ], "in_model": true, "uncertain": false, "structure": { "accession": "P08151", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/P08151", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-P08151-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-P08151-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/P08151", "mean_plddt": 45.5, "plddt_band": "Very low (<50)", "n_residues": 1106, "local_pdb": "digital_twin\\data\\structures\\P08151_AF.pdb" }, "uniprot": "P08151", "uniprot_name": "Zinc finger protein GLI1", "length": 1106, "function": "Acts as a transcriptional activator (PubMed:10806483, PubMed:19706761, PubMed:19878745, PubMed:24076122, PubMed:24217340, PubMed:24311597). Binds to the DNA consensus sequence 5'-GACCACCCA-3' (PubMed:2105456, PubMed:24217340, PubMed:8378770). Regulates the transcription of specific genes during normal development (PubMed:19706761). Plays a role in craniofacial development and digital development, as well as development of the central nervous system and gastrointestinal tract. Mediates SHH signaling (PubMed:19706761, PubMed:28973407). Plays a role in cell proliferation and differentiation via i", "pdb_count": 5, "pdb_ids": [ "2GLI", "4BLB", "4KMD", "5OM0", "7T91" ], "grounding": [ { "paper": "Mice with a Targeted Mutation of Patched2 Are Viable but Develop Alopecia and Epidermal Hyperplasia†", "quote": "AAA GGTCTGTTCC-3\u0003), GAPDH-F (5\u0003-GTGGCAAAGTGGAGATTGTTGCC-3\u0003), GAPDH-R (5\u0003-GATGATGACCCGTTTGGCTCC-3\u0003), Ptc1-F (5\u0003-AACAAAA ATTCAACCAAACCTC-3\u0003), Ptc1-R (5\u0003-TGTCTTCATTCCAGTTGATGTG- 3\u0003), Gli1-F (5\u0003-TTCGTGTGCCATTGGGGAGG-3\u0003), and Gli1-R (5\u0003-CTTGG GCTCCACTGTGGAGA-3\u0003). Reaction conditions are available upon re", "n_hits": 46 }, { "paper": "Multi-layered environmental regulation on the homeostasis of stem cells The saga of hair growth and alopecia", "quote": "steum [52]. 5.3. Nervous system The nervous system also plays an important role in defining properties of the hair stem cell niche. Neuronal Sonic Hedgehog (Shh) signals to induce Gli1 in neighboring cells to create a perineural stem cell niche within the telogen bulge. Gli1 positive follicle cells ", "n_hits": 4 }, { "paper": "Ox40-Cre–mediated deletion of BRD4 reveals an unexpected phenotype of hair follicle stem cells in alopecia", "quote": "cle stem cells (27), and we found that some lineage transcription factors (Lhx2, Nfib, Sox9, Dlx3) and key signaling factors (Lef1, Frfr2, Id1, Lgr4 for Wnt pathway; Gas1, Hes1, Gli1, ptch2 for SHH pathway; Cdk4, Ccne1, Aurkb for cell cycling) that are known to regulate follicle stem cells showed ex", "n_hits": 4 } ], "grounded_in_corpus": true }, { "gene": "HGF", "name": "Hepatocyte growth factor", "diseases": [ "AGA" ], "pathway": "Growth factor", "twin_node": "DP", "effect": "+", "role": "protector", "drugs": [ "HGF-based regenerative approaches (investigational)" ], "mechanism": "DP 발모 인자.", "evidence_paper_ids": [], "n_evidence": 0, "mention_count": 0, "sources": [ "discover:AGA", "seed" ], "in_model": true, "uncertain": false, "structure": { "accession": "P14210", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/P14210", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-P14210-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-P14210-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/P14210", "mean_plddt": 83.5, "plddt_band": "Confident (70–90)", "n_residues": 728, "local_pdb": "digital_twin\\data\\structures\\P14210_AF.pdb" }, "uniprot": "P14210", "uniprot_name": "Hepatocyte growth factor", "length": 728, "function": "Potent mitogen for mature parenchymal hepatocyte cells, seems to be a hepatotrophic factor, and acts as a growth factor for a broad spectrum of tissues and cell types (PubMed:20624990). Activating ligand for the receptor tyrosine kinase MET by binding to it and promoting its dimerization (PubMed:15167892, PubMed:20977675). Activates MAPK signaling following TMPRSS13 cleavage and activation (PubMed:20977675)", "pdb_count": 36, "pdb_ids": [ "1BHT", "1GMN", "1GMO", "1GP9", "1NK1", "1SHY", "1SI5", "2HGF" ], "grounding": [ { "paper": "Exploring the Efficacy and Potential Mechanisms of Topical Periplaneta americana (L.) Extract in Treating Androgenetic Alopecia in a Mouse Model A Systems Pharmacology and Skin Microbiome Analysis", "quote": "as purchased from Aladdin Reagent Co., Ltd. (Shanghai, China). Isoflurane was purchased from Reward Technology Co., Ltd. (Jinan, China). Vascular endothelial growth factor (VEGF), Hepatocyte Growth Factor (HGF), alkaline phosphatase (ALP/AKP), estradiol (E2), malondialdehyde (MDA), tumor necrosis fa", "n_hits": 14 }, { "paper": "Cell-free fat extract restores hair loss a novel therapeutic strategy for androgenetic alopecia", "quote": "\u0007Conditioned media DHT \u0007Dihydrotestosterone DPCs \u0007Dermal papilla cells ELISA \u0007Enzyme-linked immunosorbent assay hDPCs \u0007Human dermal papilla cells HE \u0007Hematoxylin–eosin HGF \u0007Hepatocyte growth factor IGF \u0007Insulin-like growth factor MLA assay \u0007Mouse lymohoma TK assay PDGF \u0007Platelet-derived growth facto", "n_hits": 6 }, { "paper": "Cell-free fat extract restores hair loss a novel therapeutic strategy for androgenetic alopecia", "quote": "\u0007Conditioned media DHT \u0007Dihydrotestosterone DPCs \u0007Dermal papilla cells ELISA \u0007Enzyme-linked immunosorbent assay hDPCs \u0007Human dermal papilla cells HE \u0007Hematoxylin–eosin HGF \u0007Hepatocyte growth factor IGF \u0007Insulin-like growth factor MLA assay \u0007Mouse lymohoma TK assay PDGF \u0007Platelet-derived growth facto", "n_hits": 6 }, { "paper": "Overcoming the Low Bioavailability of Apigenin The Therapeutic Efficacy for Androgenetic Alopecia Through Topical Administration", "quote": "β (GSK-­3β) is a key regulator of the Wnt signaling pathway, which is crucial for hair follicle development and hair cycling. Inhibiting GSK-­3β leads to promoting hair growth. Hepatocyte growth factor (HGF) is secreted by cells in the hair follicle, particularly the DPC, and it stimulates neighbori", "n_hits": 6 } ], "grounded_in_corpus": true }, { "gene": "HMOX1", "name": "Heme oxygenase 1", "diseases": [ "AGA" ], "pathway": "Oxidative stress", "twin_node": "APO", "effect": "-", "role": "protector", "drugs": [ "sulforaphane(Nrf2)" ], "mechanism": "항산화 방어.", "evidence_paper_ids": [], "n_evidence": 0, "mention_count": 0, "sources": [ "seed" ], "in_model": true, "uncertain": false, "structure": { "accession": "P09601", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/P09601", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-P09601-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-P09601-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/P09601", "mean_plddt": 82.9, "plddt_band": "Confident (70–90)", "n_residues": 288, "local_pdb": "digital_twin\\data\\structures\\P09601_AF.pdb" }, "uniprot": "P09601", "uniprot_name": "Heme oxygenase 1", "length": 288, "function": "Catalyzes the oxidative cleavage of heme at the alpha-methene bridge carbon, released as carbon monoxide (CO), to generate biliverdin IXalpha, while releasing the central heme iron chelate as ferrous iron (PubMed:11121422, PubMed:19556236, PubMed:7703255). Affords protection against programmed cell death and this cytoprotective effect relies on its ability to catabolize free heme and prevent it from sensitizing cells to undergo apoptosis (PubMed:20055707)", "pdb_count": 26, "pdb_ids": [ "1N3U", "1N45", "1NI6", "1OYK", "1OYL", "1OZE", "1OZL", "1OZR" ], "grounding": [ { "paper": "Schizochytrium sp. Extracted Lipids Prevent Alopecia by Enhancing Antioxidation and Inhibiting Ferroptosis of Dermal Papilla Cells", "quote": "sis shows that the ferroptosis signaling pathway was signifi- cantly influenced by SEL. A total of five genes in ferroptosis were upregulated after the SEL treatment, including GCLM, HMOX1, SLC7A11, FTH1, and Homo_sapiens_newGene_19841 (Figure 4a). The glutamate–cysteine ligase modifier subunit (GCLM, E", "n_hits": 30 }, { "paper": "ISEV2025 Abstract Book.", "quote": "with muscle invasiveness, and a trained classifier could predict UBC with 92% accuracy. Some 96 of 555 Journal of Extracellular Vesicles, 2025 differentially expressed proteins, HO-1 and MMP7, were analysed by bead-based flow cytometry, where HO-1 was detected on the EV surface. Summary/Conclusion: ", "n_hits": 15 }, { "paper": "Jiawei Erzhiwan Ameliorates Androgenetic Alopecia by Regulating the SIRT1 JNK p38 MAPK Pathway", "quote": "ed the effects of DHT. To confirm our findings, we comparatively examined the levels of MDA, GSH and SOD (Figure 4F–H), as well as the expression of cyclooxygenase 2 (COX-2) and heme oxygenase 1 (HO-1) (Figure 4I and J), in the dorsal skin of different murine groups. And the result provided similar ", "n_hits": 13 }, { "paper": "Interdisciplinarity traditional Chinese medicine microneedles in skin disease treatment Recent advances and challenges.", "quote": ", as well as antioxidant activities [73–75]. Notably, Rg3 can prevent oxidative stress damage to human skin fibroblasts by lowering ROS creation, raising NRF2, and encour­ aging heme oxygenase (HO-1) expression [76,77]. Furthermore, it has been reported that Rg3 can protect through its antioxidant c", "n_hits": 10 } ], "grounded_in_corpus": true }, { "gene": "HR", "name": "Protein hairless", "diseases": [ "CIA", "Other" ], "pathway": "Nuclear receptor", "twin_node": "HFSC", "effect": "+", "role": "modulator", "drugs": [], "mechanism": "VDR 보조억제자; 변이 시 atrichia.", "evidence_paper_ids": [], "n_evidence": 0, "mention_count": 0, "sources": [ "discover:CIA", "seed" ], "in_model": true, "uncertain": false, "structure": { "accession": "O43593", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/O43593", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-O43593-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-O43593-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/O43593", "mean_plddt": 55.2, "plddt_band": "Low (50–70)", "n_residues": 1189, "local_pdb": "digital_twin\\data\\structures\\O43593_AF.pdb" }, "uniprot": "O43593", "uniprot_name": "Lysine-specific demethylase hairless", "length": 1189, "function": "Histone demethylase that specifically demethylates both mono- and dimethylated 'Lys-9' of histone H3. May act as a transcription regulator controlling hair biology (via targeting of collagens), neural activity, and cell cycle", "pdb_count": 0, "pdb_ids": [], "grounding": [ { "paper": "A missense mutation in Lama3 causes androgen alopecia", "quote": "netic alopecia have caused serious disturbances to normal human life. Animal models play an important role in exploring pathogenesis of disease and evaluating new therapies. NIH hairless mice are a spontaneous hairless mouse discovered and bred in our laboratory. In this study, we resequenced the ge", "n_hits": 35 }, { "paper": "Selective Expansion of Tregs Using the IL-2 Cytokine Antibody Complex Does Not Reverse Established Alopecia Areata in C3H HeJ Mice", "quote": "on this, we tested the therapeutic potential of expanded Tregs in AA using the C3H/HeJ mouse model. In mice with AA, NKG2D- expressing CD8 T cells widely infiltrate both haired and hairless skin areas, which have tissue-resident memory T-cell phenotypes. Tregs in the skin express CD25, CTLA-4, GATA-3", "n_hits": 6 }, { "paper": "Vitamin D3 Analogs Stimulate Hair Growth in Nude Mice", "quote": "nactivating mutation of VDR, with either partial or total alopecia (26). Studies using VDR knockout mice have shown that keratinocytes are the aberrant cells responsible for their hairless phenotype (23, 27). Keratinocytes express Whn, and hair reconstitution assays revealed them to be the defective", "n_hits": 6 }, { "paper": "Gene therapy for alopecia in type II rickets model rats using vitamin D receptor-expressing adenovirus vector", "quote": "have demonstrated that complex formation by VDR and other factors in keratinocytes is essential for the maintenance of the hair ­cycle16,17. In addition, the interaction between Hairless and the VDR-RXR complex may be essential for the regulation of hair follicle cycling, including the hedgehog sign", "n_hits": 4 } ], "grounded_in_corpus": true }, { "gene": "IL7R", "name": "Interleukin-7 receptor subunit alpha", "diseases": [ "AA" ], "pathway": "JAK-STAT", "twin_node": "INF", "effect": "+", "role": "driver", "drugs": [ "anti-IL7R" ], "mechanism": "IL-7 신호 차단 시 AA 반전.", "evidence_paper_ids": [], "n_evidence": 0, "mention_count": 0, "sources": [ "discover:AA", "seed" ], "in_model": true, "uncertain": false, "structure": { "accession": "P16871", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/P16871", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-P16871-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-P16871-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/P16871", "mean_plddt": 67.5, "plddt_band": "Low (50–70)", "n_residues": 459, "local_pdb": "digital_twin\\data\\structures\\P16871_AF.pdb" }, "uniprot": "P16871", "uniprot_name": "Interleukin-7 receptor subunit alpha", "length": 459, "function": "Receptor for interleukin-7. Also acts as a receptor for thymic stromal lymphopoietin (TSLP)", "pdb_count": 7, "pdb_ids": [ "3DI2", "3DI3", "3UP1", "5J11", "6P50", "6P67", "7OPB" ], "grounding": [ { "paper": "Blockade of IL-7 signaling suppresses inflammatory responses and reverses alopecia areata in C3H HeJ mice", "quote": "Dai et al., Sci. Adv. 2021; 7 : eabd1866 2 April 2021 SCIE N C E A D V A NCES | RESEA R CH A RT ICL E 1 of 13 I M MUNOLOGY Blockade of IL-7 signaling suppresses inflammatory responses and reverses alopecia areata in C3H/HeJ mice Zhenpeng Dai1, Eddy Hsi Chun Wang1, Lynn Petukhova1, Yuqian Chang1, Eun", "n_hits": 146 }, { "paper": "Selective inhibition of JAK3 signaling is sufficient to reverse alopecia areata", "quote": "6651600 (JAK3i) with various cytokines (Supplemental Table 1; supplemental material available online with this article; https://doi.org/10.1172/jci.insight.142205DS1). We tested IL-7 and IL-15, which signal through JAK1/3 and lead to STAT5 tyrosine phosphorylation, and found that INCB039110 and PF-0", "n_hits": 4 }, { "paper": "Extracellular vesicles in age-related diseases disease pathogenesis, intervention, and biomarker.", "quote": "types of occupation, types of sports, and previous injury, also contribute to initiation, promotion and progression of OA [145]. Pro-inflamma- tory cytokines such as IL-1, IL-6, IL-7, IL-8, IL-17, IL-18, IL-20, IL-36, MCP-2, MIF, MIG, oncostatin M, bFGF, TGFα, S100 proteins, are found in OA joints, ", "n_hits": 2 }, { "paper": "Hair follicle-derived mesenchymal stem cells decrease alopecia areata mouse hair loss and reduce inflammation around the hair follicle", "quote": "ion [39], which indicated significant treatment in androgenic alopecia patients. But clinical studies for AA therapy are limited. The preclinical study indicated that short-term IL-7 receptors in combination with low doses of Treg-tropic cytokines increased therapeutic effects in AA treatment [40]. ", "n_hits": 2 } ], "grounded_in_corpus": true }, { "gene": "KRT17", "name": "Keratin, type I cytoskeletal 17", "diseases": [ "CIA", "Other" ], "pathway": "Structural keratin", "twin_node": "DP", "effect": "+", "role": "modulator", "drugs": [], "mechanism": "모낭 keratin; 결핍 시 연령의존 탈모.", "evidence_paper_ids": [], "n_evidence": 0, "mention_count": 0, "sources": [ "discover:CIA", "seed" ], "in_model": true, "uncertain": false, "structure": { "accession": "Q04695", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/Q04695", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-Q04695-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-Q04695-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/Q04695", "mean_plddt": 77.3, "plddt_band": "Confident (70–90)", "n_residues": 432, "local_pdb": "digital_twin\\data\\structures\\Q04695_AF.pdb" }, "uniprot": "Q04695", "uniprot_name": "Keratin, type I cytoskeletal 17", "length": 432, "function": "Type I keratin involved in the formation and maintenance of various skin appendages, specifically in determining shape and orientation of hair (By similarity). Required for the correct growth of hair follicles, in particular for the persistence of the anagen (growth) state (By similarity). Modulates the function of TNF in the specific context of hair cycling. Regulates protein synthesis and epithelial cell growth through binding to the adapter protein SFN and by stimulating Akt/mTOR pathway (By similarity). Involved in tissue repair. May be a marker of basal cell differentiation in complex epi", "pdb_count": 0, "pdb_ids": [], "grounding": [ { "paper": "Keratin 17 null mice exhibit age- and strain-dependent alopecia", "quote": "Keratin 17 null mice exhibit age- and strain-dependent alopecia Kevin M. McGowan,1,4 Xuemei Tong,1,4 Emma Colucci-Guyon,3 Francina Langa,3 Charles Babinet,3 and Pierre A. Coulombe1,2,5 1Depa", "n_hits": 219 }, { "paper": "Keratin 17 null mice exhibit ageand strain-dependent alopecia", "quote": "Keratin 17 null mice exhibit age- and strain-dependent alopecia Kevin M. McGowan,1,4 Xuemei Tong,1,4 Emma Colucci-Guyon,3 Francina Langa,3 Charles Babinet,3 and Pierre A. Coulombe1,2,5 1Depa", "n_hits": 219 }, { "paper": "Gene Array Profiling and Immunomodulation Studies Define a Cell-Mediated Immune Response Underlying the Pathogenesis of Alopecia Areata in a Mouse Model and Humans", "quote": "0 Hair basic keratin 1 (Hb1) KRTHB1: keratin, hair, basic, 1 ± 28 X99141 Hb3 KRTHB3: keratin, hair, basic, 3 ± 17 X99140 Hb5 KRTHB5: keratin, hair, basic, 5 ± 32 Z19574 K17 KRT17: keratin 17 ± 5 X12876 K18 KRT18: keratin 18 ± 4.3 X07696 High-sulfur keratin 1 KRT15: keratin 15 ± 7.3 U42408 Ladinin LA", "n_hits": 3 }, { "paper": "Periplaneta americana extract (L.) promotes hair regrowth in Alopecia areata mice by reducing inflammation and modulating skin microbiota", "quote": "Vibrionaceae_Vibrio was positively correlated with mt-Co1, mt- Cytb, mt-Nd1, mt-Nd4, and mt-Nd5; Jeotgalicoccus was positively correlated with mt-Cytb, mt-Nd2, mt-Nd4, mt-Nd5, and Krt17; Aerococcus was positively correlated with mt-Nd5 and Krt17; Streptococcus was positively correlated with B2m, Tpt", "n_hits": 2 } ], "grounded_in_corpus": true }, { "gene": "LAMA5", "name": "Laminin subunit alpha-5 (laminin-511)", "diseases": [ "CIA" ], "pathway": "ECM/adhesion", "twin_node": "DP", "effect": "+", "role": "protector", "drugs": [ "Laminin-511-E8 fragment (experimental)" ], "mechanism": "발모 유도 기저막; CIA 에서 하향.", "evidence_paper_ids": [], "n_evidence": 0, "mention_count": 0, "sources": [ "discover:CIA", "seed" ], "in_model": true, "uncertain": false, "structure": { "accession": "O15230", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/O15230", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-O15230-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-O15230-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/O15230", "mean_plddt": 79.1, "plddt_band": "Confident (70–90)", "n_residues": 561, "local_pdb": "digital_twin\\data\\structures\\O15230_AF.pdb" }, "uniprot": "O15230", "uniprot_name": "Laminin subunit alpha-5", "length": 3695, "function": "Binding to cells via a high affinity receptor, laminin is thought to mediate the attachment, migration and organization of cells into tissues during embryonic development by interacting with other extracellular matrix components. Plays a role in the regulation of skeletogenesis, through a mechanism that involves integrin-mediated signaling and PTK2B/PYK2 (PubMed:33242826)", "pdb_count": 2, "pdb_ids": [ "5XAU", "7CEC" ], "grounding": [ { "paper": "Laminin-511, inducer of hair growth, is down-regulated and its suppressor in hair growth, laminin-332 up-regulated in chemotherapy-induced alopecia", "quote": "Laminin-511, inducer of hair growth, is down-regulated and its suppressor in hair growth, laminin-332 up-regulated in chemotherapy-induced alopecia Hisayoshi Imanishia, Daisuke Tsurutaa,*, Ch", "n_hits": 110 }, { "paper": "Genetic analysis of a novel antioxidant multi-target iron chelator, M30 protecting against chemotherapy-induced alopecia in mice", "quote": "ved from skin biopsy specimens of normal mice, cyclophosphamide-treated mice, and cyclophosphamide treated mice with M30 supplement. Results: The top genes namely Tnfrsf19, Ercc2, Lama5, Ctsl, and Per1 were identified by microarray analysis. These genes were found to be involved in the biological pr", "n_hits": 8 }, { "paper": "A missense mutation in Lama3 causes androgen alopecia", "quote": "_034810.1: p.Arg217Cys). This is an unreported SNP locus that is completely linked to the phenotype. Laminin, a major component of the basement membrane, includes three isoforms, laminin-511, laminin-332, and laminin-211, and the Lama3 gene encodes the alpha subunit of laminin-332. Basement mem- bra", "n_hits": 7 }, { "paper": "Molecular signatures and signaling interactions of the hair follicle stem cell niche.", "quote": "HGSC-specific ligand Shh, in addition to potential interaction with Hhip and Gpc5, may bind to both Ptch1/Smo and Ptch2/Smo in the DP (Hsu et al., 2014) (Figure 6e). HG-DP pairs Lama5→Sdc1, Lama5→Itgb1, Thbs1→Itgb1 and Thbs1→Lrp1 might regulate DP structural integrity (Hoffman et al., 1998, Resovi e", "n_hits": 2 } ], "grounded_in_corpus": true }, { "gene": "LGR5", "name": "Leucine-rich repeat GPCR 5", "diseases": [ "AGA" ], "pathway": "HFSC niche", "twin_node": "HFSC", "effect": "+", "role": "protector", "drugs": [], "mechanism": "활성형 모낭 줄기세포 마커(Wnt 표적).", "evidence_paper_ids": [], "n_evidence": 0, "mention_count": 0, "sources": [ "discover:HFSC", "seed" ], "in_model": true, "uncertain": false, "structure": { "accession": "O75473", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/O75473", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-O75473-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-O75473-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/O75473", "mean_plddt": 80.2, "plddt_band": "Confident (70–90)", "n_residues": 907, "local_pdb": "digital_twin\\data\\structures\\O75473_AF.pdb" }, "uniprot": "O75473", "uniprot_name": "Leucine-rich repeat-containing G-protein coupled receptor 5", "length": 907, "function": "Receptor for R-spondins that potentiates the canonical Wnt signaling pathway and acts as a stem cell marker of the intestinal epithelium and the hair follicle. Upon binding to R-spondins (RSPO1, RSPO2, RSPO3 or RSPO4), associates with phosphorylated LRP6 and frizzled receptors that are activated by extracellular Wnt receptors, triggering the canonical Wnt signaling pathway to increase expression of target genes. In contrast to classical G-protein coupled receptors, does not activate heterotrimeric G-proteins to transduce the signal. Involved in the development and/or maintenance of the adult i", "pdb_count": 7, "pdb_ids": [ "4BSR", "4BSS", "4BST", "4BSU", "4KNG", "4UFR", "4UFS" ], "grounding": [ { "paper": "Disrupted cholesterol biosynthesis and hair follicle stem cell impairment in the onset of alopecia", "quote": "treated with 25mM 7 DHC, 4mM BM15766 for 24 hours. The cells then underwent washing, fixing, and permeabilization [19] and were incubated with targeted primary antibodies SOX 9, LGR5, and Wnt 5A, purchased from ImmunoTag (St. Louis, MO, USA, Cat# ITT02816). Subsequently, the cells were exposed to DA", "n_hits": 76 }, { "paper": "Modified Huanjingjian Prevents Chemotherapy-Induced Alopecia by Inhibiting Genomic DNA Methylation of the Wnt Signaling Pathway in Mice", "quote": "in each at room temperature. Subsequently, the sections were incubated at 37 °C for 45 min with primary antibodies diluted in IF blocking buffer. The primary antibodies included: Lgr5 (ab273092), CD49f (Integrin α6, ab181551), SOX9 (ab185966), S100A4 (ab93283), CK15 (ab52816), and FZD10 (ab137491) (", "n_hits": 16 }, { "paper": "Low-frequency electromagnetic fields ameliorate testosterone-induced androgenetic alopecia in mice through LncRNA H19 miR-214-5p β-catenin signal pathway", "quote": "emerge from the tissue (10 9 10); D Day 7 after primary culture (scattered HFSCs, 10 9 10); E: 1st generation; F 2nd generation; G Identification of HFSCs by flow cytometry using LGR5 (+), CD200 (+), CD271 (−), and CK15 (−) as markers. J.-H. Cheng et al.", "n_hits": 12 }, { "paper": "Molecular signatures and signaling interactions of the hair follicle stem cell niche.", "quote": "Invest Dermatol. Author manuscript; available in PMC 2026 February 06. Author Manuscript Author Manuscript Author Manuscript Author Manuscript 2005) and Wnt signaling co-receptor Lgr5 (Jaks et al., 2008) were expressed in the Core and 3-Zones signatures (Figure 4c, Supplementary Figure S7a and b). F", "n_hits": 10 } ], "grounded_in_corpus": true }, { "gene": "LRP6", "name": "LDL receptor-related protein 6", "diseases": [ "AGA" ], "pathway": "Wnt/β-catenin", "twin_node": "Wnt", "effect": "+", "role": "protector", "drugs": [], "mechanism": "Wnt 공수용체; DKK1 의 차단 표적.", "evidence_paper_ids": [], "n_evidence": 0, "mention_count": 0, "sources": [ "discover:AGA", "seed" ], "in_model": true, "uncertain": false, "structure": { "accession": "O75581", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/O75581", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-O75581-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-O75581-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/O75581", "mean_plddt": 79.2, "plddt_band": "Confident (70–90)", "n_residues": 1613, "local_pdb": "digital_twin\\data\\structures\\O75581_AF.pdb" }, "uniprot": "O75581", "uniprot_name": "Low-density lipoprotein receptor-related protein 6", "length": 1613, "function": "Component of the Wnt-Fzd-LRP5-LRP6 complex that triggers beta-catenin signaling through inducing aggregation of receptor-ligand complexes into ribosome-sized signalosomes (PubMed:11357136, PubMed:11448771, PubMed:15778503, PubMed:16341017, PubMed:16513652, PubMed:17326769, PubMed:17400545, PubMed:19107203, PubMed:19293931, PubMed:19801552, PubMed:28341812, PubMed:34896607). Cell-surface coreceptor of Wnt/beta-catenin signaling, which plays a pivotal role in various processes including retinal angiogenesis and bone formation (PubMed:11357136, PubMed:11448771, PubMed:15778503, PubMed:16341017, P", "pdb_count": 27, "pdb_ids": [ "3S2K", "3S8V", "3S8Z", "3S94", "3SOB", "3SOQ", "3SOV", "4A0P" ], "grounding": [ { "paper": "Molecular signatures and signaling interactions of the hair follicle stem cell niche.", "quote": "both HGSCs and BuSCs and known to regulate SC quiescence (Botchkarev et al., 2001, Kobielak et al., 2003). Wnt5a or Wnt6 interacting with Frizzled receptors, Fzd1, Fzd2 and Fzd7/Lrp6 co-receptors also play an important role in Wnt signaling crosstalk (Zeng et al., 2008). Less-well known interactions", "n_hits": 4 } ], "grounded_in_corpus": true }, { "gene": "MSX2", "name": "Homeobox protein MSX-2", "diseases": [ "CIA", "Other" ], "pathway": "BMP/TGFβ", "twin_node": "BMP", "effect": "+", "role": "modulator", "drugs": [], "mechanism": "모발 주기·모간 분화; 변이 시 cyclic alopecia.", "evidence_paper_ids": [], "n_evidence": 0, "mention_count": 0, "sources": [ "discover:CIA", "seed" ], "in_model": true, "uncertain": false, "structure": { "accession": "P35548", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/P35548", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-P35548-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-P35548-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/P35548", "mean_plddt": 67.4, "plddt_band": "Low (50–70)", "n_residues": 267, "local_pdb": "digital_twin\\data\\structures\\P35548_AF.pdb" }, "uniprot": "P35548", "uniprot_name": "Homeobox protein MSX-2", "length": 267, "function": "Acts as a transcriptional regulator in bone development. Represses the ALPL promoter activity and antagonizes the stimulatory effect of DLX5 on ALPL expression during osteoblast differentiation. Probable morphogenetic role. May play a role in limb-pattern formation. In osteoblasts, suppresses transcription driven by the osteocalcin FGF response element (OCFRE). Binds to the homeodomain-response element of the ALPL promoter", "pdb_count": 0, "pdb_ids": [], "grounding": [ { "paper": "‘Cyclic alopecia’ in Msx2 mutants defects in hair cycling and hair shaft differentiation", "quote": "‘Cyclic alopecia’ in Msx2 mutants: defects in hair cycling and hair shaft differentiation Liang Ma1,2, Jian Liu3, Tobey Wu3, Maksim Plikus3, Ting-Xin Jiang3, Qun Bi2, Yi-Hsin Liu4, Sven Müller-Röver5, He", "n_hits": 159 }, { "paper": "Secretory phospholipase A2-IIA overexpressing mice exhibit cyclic alopecia mediated through aberrant hair shaft differentiation and impaired wound healing response", "quote": "tly, sPLA2-IIA overexpression affects the hair shaft differentiation leading to development of cyclic alopecia. Molecular investigation study showed aberrant expression of Sox21, Msx2 and signalling modulators necessary for proper differentiation of inner root sheath (IRS) and hair shaft formation. ", "n_hits": 10 }, { "paper": "Overexpression of MYB in the skin induces alopecia and epidermal hyperplasia", "quote": "genes (Lce1 and Lce3) or hornerin (Hrnr) (Fig. 5a and Table S2). Interestingly, multiple genes, including transcription factors, that control hair follicle differentiation (e.g. Msx2, Bmp2, Bmp4, Foxn1, Efl5, Hoxc13 and Lhx2) were found downregulated in the skin of K5-Myb mice (Figs. 5a and Table S2", "n_hits": 6 }, { "paper": "Alopecia in a Viable Phospholipase C Delta 1 and Phospholipase C Delta 3 Double Mutant", "quote": ") [59– 63]. Three important transcription factors involved in the transcription of hair keratin and keratin associated protein encoding genes in mice and humans [51,64–74], Foxn1, Msx2 and Hoxc13, showed unaltered expression between wild-type and oltSH and oltNH mutants. The expression levels of gen", "n_hits": 3 } ], "grounded_in_corpus": true }, { "gene": "MTOR", "name": "Mechanistic target of rapamycin", "diseases": [ "AGA" ], "pathway": "PI3K-AKT-mTOR", "twin_node": "DP", "effect": "+", "role": "protector", "drugs": [ "rapamycin (mTOR inhibitor; context-dependent effects on follicle)" ], "mechanism": "ROS-mTOR 불활성화 시 모발 재생 손상(arginine 대사).", "evidence_paper_ids": [], "n_evidence": 0, "mention_count": 0, "sources": [ "discover:AGA", "seed" ], "in_model": true, "uncertain": false, "structure": { "accession": "P42345", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/P42345", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-P42345-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-P42345-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/P42345", "mean_plddt": 78.0, "plddt_band": "Confident (70–90)", "n_residues": 2549, "local_pdb": "digital_twin\\data\\structures\\P42345_AF.pdb" }, "uniprot": "P42345", "uniprot_name": "Serine/threonine-protein kinase mTOR", "length": 2549, "function": "Serine/threonine protein kinase which is a central regulator of cellular metabolism, growth and survival in response to hormones, growth factors, nutrients, energy and stress signals (PubMed:12087098, PubMed:12150925, PubMed:12150926, PubMed:12231510, PubMed:12718876, PubMed:14651849, PubMed:15268862, PubMed:15467718, PubMed:15545625, PubMed:15718470, PubMed:18497260, PubMed:18762023, PubMed:18925875, PubMed:20516213, PubMed:20537536, PubMed:21659604, PubMed:23429703, PubMed:23429704, PubMed:25799227, PubMed:26018084, PubMed:29150432, PubMed:29236692, PubMed:31112131, PubMed:31601708, PubMed:3", "pdb_count": 54, "pdb_ids": [ "1AUE", "1FAP", "1NSG", "2FAP", "2GAQ", "2NPU", "2RSE", "3FAP" ], "grounding": [ { "paper": "Corticotropin-releasing hormone inhibits autophagy by suppressing PTEN to promote apoptosis in dermal papilla cells", "quote": "suppress autophagy, leading to DPC apoptosis. Overexpression of PTEN enhanced autophagy and mitigated CRH-dependent DPC apoptosis. CRH inhibited PTEN and activated the PI3K/AKT/mTOR pathway, whereas rapamycin inhibited this pathway and activated autophagy, consequently lowering apoptosis, suggesting", "n_hits": 31 }, { "paper": "The human umbilical cord-mesenchymal stem cell secretome regulates hair growth and cycle transition by promoting methylthioadenosine synthesis via the PI3K AKT mTOR pathway", "quote": "ermal papilla cells and hair matrix cells through cysteine and methionine metabolism; and stimulates methylthioadenosine synthesis in hair matrix cells by activating the PI3K/AKT/mTOR signaling pathway. Clinical studies demonstrated that SCT increased human hair density and average hair diameter. Sc", "n_hits": 30 }, { "paper": "Arginine Metabolic Disruption Impairs Hair Regeneration via ROS‐Mediated Inactivation of mTOR Signaling in Androgenetic Alopecia", "quote": "RESEARCH ARTICLE www.advancedscience.com Arginine Metabolic Disruption Impairs Hair Regeneration via ROS-Mediated Inactivation of mTOR Signaling in Androgenetic Alopecia Shixin Duan, Guo Li, Yanji Chu, Junbo Zhang, Li Yang, Yujin Zhang, Fangfen Liu, Jiayun Li, Mengting Chen, Ben Wang, Zhixiang Zhao,", "n_hits": 28 }, { "paper": "Multifunctional nanomedicine targeting the 'seed-and-soil' of hair follicles via simultaneous alleviation of oxidative stress and activation of autophagy for androgenetic alopecia therapy", "quote": "mitigate oxidative stress and inhibiting intracellular oxidative damage via the suppression of c-Jun phosphorylation. Addi­ tionally, Cur inhibits the phosphorylation of Akt and mTOR, which in turn promotes the expression of LC3B and activates the autophagy pathway. Thus, Cur’s ability to both reduc", "n_hits": 16 } ], "grounded_in_corpus": true }, { "gene": "NLRP3", "name": "NACHT/LRR/PYD protein 3", "diseases": [ "AA" ], "pathway": "Inflammasome", "twin_node": "INF", "effect": "+", "role": "driver", "drugs": [ "MCC950", "NLRP3 inhibitors (preclinical)", "total glucosides of paeony" ], "mechanism": "caspase-1/GSDMD pyroptosis; AA 모낭 염증.", "evidence_paper_ids": [], "n_evidence": 0, "mention_count": 0, "sources": [ "discover:AA", "seed" ], "in_model": true, "uncertain": false, "structure": { "accession": "Q96P20", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/Q96P20", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-Q96P20-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-Q96P20-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/Q96P20", "mean_plddt": 81.1, "plddt_band": "Confident (70–90)", "n_residues": 1036, "local_pdb": "digital_twin\\data\\structures\\Q96P20_AF.pdb" }, "uniprot": "Q96P20", "uniprot_name": "NACHT, LRR and PYD domains-containing protein 3", "length": 1036, "function": "Sensor component of the NLRP3 inflammasome, which mediates inflammasome activation in response to defects in membrane integrity, leading to secretion of inflammatory cytokines IL1B and IL18 and pyroptosis (PubMed:16407889, PubMed:18403674, PubMed:18604214, PubMed:23582325, PubMed:25686105, PubMed:27929086, PubMed:28656979, PubMed:28847925, PubMed:30487600, PubMed:30612879, PubMed:31086327, PubMed:31086329, PubMed:31189953, PubMed:33231615, PubMed:34133077, PubMed:34341353, PubMed:34512673, PubMed:36442502, PubMed:40450990). In response to pathogens and other damage-associated signals that affe", "pdb_count": 23, "pdb_ids": [ "2NAQ", "3QF2", "6NPY", "7ALV", "7PZC", "7PZD", "7VTP", "7ZGU" ], "grounding": [ { "paper": "Total glucosides of paeony inhibit NLRP3 caspase-1 GSDMD-mediated inflammation and pyroptosis in C3H HeJ mice with alopecia areata", "quote": "s://creativecommons.org/licenses/by/4.0/). Biomolecules and Biomedicine, 2025, Vol. 25, No. 4, 954–964 954 www.biomolbiomed.com RESEARCH ARTICLE Total glucosides of paeony inhibit NLRP3/caspase-1/GSDMD-mediated inflammation and pyroptosis in C3H/HeJ mice with alopecia areata Jingfang Zhang 1,2, Zhiq", "n_hits": 55 }, { "paper": "Induction of alopecia areata in C3H HeJ mice using polyinosinic-polycytidylic acid (poly[IC]) and interferon-gamma", "quote": "chemical staining of the AA lesions revealed increased infiltration of CD4+ and CD8+ cells infiltration around the hair follicles. IFNγ and poly(I:C) increased the expression of NLRP3, IL-1β, CXCL9, CXCL10, and CXCL11 in mouse skin. Taken together, these findings indicate a shorter and more convenie", "n_hits": 53 }, { "paper": "ISEV2025 Abstract Book.", "quote": "the extracellular space Invited Speaker: Janis A. Müller Philipps University Marburg, Germany OF14.1 Human milk-derived extracellular vesicles reduce NF-kB pathway activation and NLRP3 inflammasome formation in vitro and in vivo Jueqin Lu, Jasmyne A. Storm, Mon Fran Obtial, Sanoji Wijenayake Departm", "n_hits": 37 }, { "paper": "Modulating immune responses in alopecia therapeutic insights and potential targets of antisense oligonucleotides", "quote": "antibodies: rabbit anti-IL-6 (Cat# ab208113, RRID: AB_2927421, Abcam; 1:1000), mouse anti-TNF-α (Cat# sc-52746, RRID: AB_630341, Santa Cruz Bio­ technology; 1:1500), mouse anti-NLRP3 (Cat# AG- 20B-0014-C100, RRID: AB_2885199, AdipoGen; 1:1500), rabbit anti-AR (Cat# D6F11, RRID: AB_2799166, Cell Sign", "n_hits": 14 } ], "grounded_in_corpus": true }, { "gene": "NOG", "name": "Noggin", "diseases": [ "AGA", "CIA" ], "pathway": "BMP/TGFβ", "twin_node": "BMP", "effect": "-", "role": "protector", "drugs": [ "recombinant noggin (investigational)" ], "mechanism": "BMP 길항제, anagen 개시 촉진.", "evidence_paper_ids": [], "n_evidence": 0, "mention_count": 0, "sources": [ "discover:AGA", "discover:CIA", "seed" ], "in_model": true, "uncertain": false, "structure": { "accession": "Q13253", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/Q13253", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-Q13253-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-Q13253-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/Q13253", "mean_plddt": 86.1, "plddt_band": "Confident (70–90)", "n_residues": 232, "local_pdb": "digital_twin\\data\\structures\\Q13253_AF.pdb" }, "uniprot": "Q13253", "uniprot_name": "Noggin", "length": 232, "function": "Inhibitor of bone morphogenetic proteins (BMP) signaling which is required for growth and patterning of the neural tube and somite. Essential for cartilage morphogenesis and joint formation. Inhibits chondrocyte differentiation through its interaction with GDF5 and, probably, GDF6 (PubMed:21976273, PubMed:26643732)", "pdb_count": 2, "pdb_ids": [ "1M4U", "7AG0" ], "grounding": [ { "paper": "‘Cyclic alopecia’ in Msx2 mutants defects in hair cycling and hair shaft differentiation", "quote": "ification and differentiation of matrix cells into hair shaft and sheath cells. BMP signaling is required during hair differentiation, as attenuation of BMP signaling by ectopic Noggin abolishes hair filament differentiation but not that of the IRS (Kulessa et al., 2000). The Wnt signaling pathway i", "n_hits": 5 }, { "paper": "Secretory phospholipase A2-IIA overexpressing mice exhibit cyclic alopecia mediated through aberrant hair shaft differentiation and impaired wound healing response", "quote": "Smad4 resulted in hyperplasia of interfollicular epidermis (IFE) and sebaceous glands (SGs), that leads to exhaustion of the SC niche and progressive hair loss26. Expression of noggin in epidermis resulted in upregulated Wnt signalling with epidermal hyperplasia, progressive hair loss, and formation", "n_hits": 2 } ], "grounded_in_corpus": true }, { "gene": "NOX4", "name": "NADPH oxidase 4", "diseases": [ "AGA" ], "pathway": "Oxidative stress", "twin_node": "APO", "effect": "+", "role": "driver", "drugs": [ "ACA(NADPH oxidase 조절)", "NOX4 inhibitors / antioxidants (investigational)" ], "mechanism": "ROS 생성; 테스토스테론 유발 탈모.", "evidence_paper_ids": [], "n_evidence": 0, "mention_count": 0, "sources": [ "discover:AGA", "seed" ], "in_model": true, "uncertain": false, "structure": { "accession": "Q9NPH5", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/Q9NPH5", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-Q9NPH5-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-Q9NPH5-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/Q9NPH5", "mean_plddt": 87.0, "plddt_band": "Confident (70–90)", "n_residues": 578, "local_pdb": "digital_twin\\data\\structures\\Q9NPH5_AF.pdb" }, "uniprot": "Q9NPH5", "uniprot_name": "NADPH oxidase 4", "length": 578, "function": "NADPH oxidase that catalyzes predominantly the reduction of oxygen to H2O2 (PubMed:14966267, PubMed:15356101, PubMed:15927447, PubMed:21343298, PubMed:25062272). Can also catalyze to a smaller extent, the reduction of oxygen to superoxide (PubMed:10869423, PubMed:11032835, PubMed:15155719, PubMed:15572675, PubMed:15927447, PubMed:16019190, PubMed:16179589, PubMed:16230378, PubMed:16324151, PubMed:25062272). May function as an oxygen sensor regulating the KCNK3/TASK-1 potassium channel and HIF1A activity (PubMed:16019190). May regulate insulin signaling cascade (PubMed:14966267). May play a rol", "pdb_count": 0, "pdb_ids": [], "grounding": [ { "paper": "A Natural Inhibitor, 1′S-1′-Acetoxychavicol Acetate, Against Testosterone-Induced Alopecia via NADPH Oxidase Regulation", "quote": "H.; Bae, D.-W.; Park, S.-B.; Kwack, M.H.; Cha, S.-S.; Jang, D.S.; Sung, Y.K.; et al. A Natural Inhibitor, 1′S-1′-Acetoxychavicol Acetate, Against Testosterone-Induced Alopecia via NADPH Oxidase Regulation. Molecules 2025, 30, 2246. https://doi.org/10.3390/ molecules30102246 Copyright: © 2025 by the ", "n_hits": 14 }, { "paper": "Overcoming the Low Bioavailability of Apigenin The Therapeutic Efficacy for Androgenetic Alopecia Through Topical Administration", "quote": "ed in Table 1. Except for Aldo-­keto reductase family 1, member B1 (AKR1B1) and Xanthine dehydrogenase (XDH), all the others are related to skin disease. Moreover, six of them (NADPH oxidase 4 (NOX4) (Jeon et al. 2023), cyclin-­dependent kinase 5 (CDK5) (Zhai et al. 2018), cytochrome P450 19A1 (CYP1", "n_hits": 14 }, { "paper": "Extracellular vesicles in age-related diseases disease pathogenesis, intervention, and biomarker.", "quote": "ing revealed that these sEVs are enriched with miR-100a-5p, which targets the 3’ untranslated region (UTR) of nico- tinamide adenine dinucleotide phosphate hydrogen oxi- dase 4 (NOX4). This targeting mitigates oxidative stress via NOX4-ROS-NRF2 axis [116]. The Bcl2 family, known for its role in apop", "n_hits": 3 }, { "paper": "ISEV2025 Abstract Book.", "quote": "s pathways. Damaged mitochondria, as the ‘cargo’ of MVs, also facilitated MVsEV71 crossing the BBB. MVsEV71 crossing the BBB further induced mitochondrial damage and activated the NOX4-derived ROS pathway in U251 cells. Summary/Conclusion: Our findings suggested that MVs trans- ported EV71 virions a", "n_hits": 2 } ], "grounded_in_corpus": true }, { "gene": "PDGFA", "name": "Platelet-derived growth factor subunit A", "diseases": [ "AGA" ], "pathway": "Growth factor", "twin_node": "DP", "effect": "+", "role": "protector", "drugs": [ "PRP", "platelet-rich plasma (delivers PDGF)" ], "mechanism": "DP-진피 상호작용·anagen 유도.", "evidence_paper_ids": [], "n_evidence": 0, "mention_count": 0, "sources": [ "discover:AGA", "seed" ], "in_model": true, "uncertain": false, "structure": { "accession": "P04085", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/P04085", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-P04085-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-P04085-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/P04085", "mean_plddt": 78.0, "plddt_band": "Confident (70–90)", "n_residues": 211, "local_pdb": "digital_twin\\data\\structures\\P04085_AF.pdb" }, "uniprot": "P04085", "uniprot_name": "Platelet-derived growth factor subunit A", "length": 211, "function": "Growth factor that plays an essential role in the regulation of embryonic development, cell proliferation, cell migration, survival and chemotaxis. Potent mitogen for cells of mesenchymal origin. Required for normal lung alveolar septum formation during embryogenesis, normal development of the gastrointestinal tract, normal development of Leydig cells and spermatogenesis. Required for normal oligodendrocyte development and normal myelination in the spinal cord and cerebellum. Plays an important role in wound healing. Signaling is modulated by the formation of heterodimers with PDGFB (By simila", "pdb_count": 1, "pdb_ids": [ "3MJK" ], "grounding": [ { "paper": "A combination therapy for androgenic alopecia based on quercetin and zinc copper dual-doped mesoporous silica nanocomposite microneedle patch", "quote": "ge >1 and false discovery rate (FDR) < 0.05 were considered as a significant difference. 2.14. The gene expression in normal or injured HHDPCs treated by ZCQ Gene expression of PDGF, TGF-β, C-Myc, MMP2 and CCN1 in normal or injured HHDPCs were detected by quantitative PCR (qPCR). Briefly, HHDPCs (1 ", "n_hits": 17 }, { "paper": "Self-assembling peptide inspired by insulin and type 1 insulin-like growth factor for the treatment of androgenetic alopecia", "quote": "ascular endothelial growth factor (VEGF), which enhanced the repair of ischemic tissues [21]. Yang et al. designed a self-assembling peptide with platelet-derived growth factor (PDGF) bioactivity, successfully promoting the healing of radiation-induced injury [22]. Subsequently, Shi et al. also empl", "n_hits": 7 }, { "paper": "Cell-free fat extract restores hair loss a novel therapeutic strategy for androgenetic alopecia", "quote": "ing with CEFFE regardless of the presence or absence of DHT. In other studies, HGF was associated with the span of the hair follicle stages, and platelet-derived growth factor (PDGF) promotes and maintains the anagen stage. Thus, we speculate that HGF and PDGF may play a crucial role in hair cycle c", "n_hits": 5 }, { "paper": "Cell-free fat extract restores hair loss a novel therapeutic strategy for androgenetic alopecia", "quote": "ing with CEFFE regardless of the presence or absence of DHT. In other studies, HGF was associated with the span of the hair follicle stages, and platelet-derived growth factor (PDGF) promotes and maintains the anagen stage. Thus, we speculate that HGF and PDGF may play a crucial role in hair cycle c", "n_hits": 5 } ], "grounded_in_corpus": true }, { "gene": "PPARG", "name": "Peroxisome proliferator-activated receptor gamma", "diseases": [ "CIA", "Scarring" ], "pathway": "Nuclear receptor", "twin_node": "HFSC", "effect": "+", "role": "protector", "drugs": [ "PPARγ agonist", "pioglitazone", "topical PPAR-gamma agonists (investigational)" ], "mechanism": "HFSC PPARγ 결핍 시 반흔성 탈모.", "evidence_paper_ids": [], "n_evidence": 0, "mention_count": 0, "sources": [ "discover:recent", "seed" ], "in_model": true, "uncertain": false, "structure": { "accession": "P37231", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/P37231", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-P37231-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-P37231-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/P37231", "mean_plddt": 76.1, "plddt_band": "Confident (70–90)", "n_residues": 505, "local_pdb": "digital_twin\\data\\structures\\P37231_AF.pdb" }, "uniprot": "P37231", "uniprot_name": "Peroxisome proliferator-activated receptor gamma", "length": 505, "function": "Ligand-activated transcription factor that forms obligate heterodimers with the retinoic acid receptor and acts as a key regulator of biological processes, such as adipocyte differentiation, lipid metabolism, glucose homeostasis and beta-oxidation of fatty acids (PubMed:16150867, PubMed:20829347, PubMed:23525231, PubMed:8702406, PubMed:8706692, PubMed:9065481). Activated by lipid ligands: binds peroxisome proliferators, such as hypolipidemic drugs, and fatty acids, such as prostaglandin J2 metabolites (PubMed:16150867, PubMed:20829347, PubMed:23525231, PubMed:8702406, PubMed:8706692, PubMed:90", "pdb_count": 316, "pdb_ids": [ "1FM6", "1FM9", "1I7I", "1K74", "1KNU", "1NYX", "1PRG", "1RDT" ], "grounding": [ { "paper": "Hair Follicle Stem Cell-Specific PPARγ Deletion Causes Scarring Alopecia", "quote": "Hair Follicle Stem Cell-Specific PPARγ Deletion Causes Scarring Alopecia Pratima Karnik1, Zenar Tekeste1, Thomas S. McCormick1, Anita C. Gilliam1, Vera H. Price2, Kevin D. Cooper1, and Paradi Mirmirani1 1Department of", "n_hits": 128 }, { "paper": "Promotion of Hair Regrowth in Androgenetic Alopecia with Supplemented Erzhi Wan Exploring Its Mechanism Using Network Pharmacology and Molecular Docking", "quote": "ylorobol NOS2 Mohanlian MOL003389 3’-O-Methylorobol PTGS1 Mohanlian MOL003389 3’-O-Methylorobol ESR1 Mohanlian MOL003389 3’-O-Methylorobol AR Mohanlian MOL003389 3’-O-Methylorobol PPARG Mohanlian MOL003389 3’-O-Methylorobol PTGS2 Mohanlian MOL003389 3’-O-Methylorobol ESR2 Mohanlian MOL003389 3’-O-Me", "n_hits": 12 }, { "paper": "Alleviation of Androgenetic Alopecia with Aqueous Paeonia lactiflora and Poria cocos Extract Intake through Suppressing the Steroid Hormone and Inflammatory Pathway", "quote": "the opposite pattern with increasing aromatase mRNA expression (p < 0.05). In the dorsal skin, DKK1 and NR3C2 mRNA expressions were significantly lower, but TGF-β2, β-Catenin, and PPARG expressions were higher in the AGA-PL and AGA-PC groups than in the AGA-Con group (p < 0.05), whereas TNF-α and IL-", "n_hits": 7 }, { "paper": "Prostaglandin D2 Inhibits Hair Growth and Is Elevated in Bald Scalp of Men with Androgenetic Alopecia", "quote": "cularly relevant; although this eicosanoid has been hypothesized to be a natural ligand for the nuclear hormone transcription factor peroxisome proliferators–activated receptor γ (PPARγ), the measured concentration of 15-dPGJ2 is often lower than the binding constant for PPARγ (17). Thus, although i", "n_hits": 6 } ], "grounded_in_corpus": true }, { "gene": "PTCH1", "name": "Protein patched homolog 1", "diseases": [ "CIA", "Other" ], "pathway": "Hedgehog", "twin_node": "SHH", "effect": "-", "role": "modulator", "drugs": [], "mechanism": "SHH 수용체(억제성); 변이 시 모낭 이상.", "evidence_paper_ids": [], "n_evidence": 0, "mention_count": 0, "sources": [ "discover:CIA", "seed" ], "in_model": true, "uncertain": false, "structure": { "accession": "Q13635", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/Q13635", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-Q13635-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-Q13635-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/Q13635", "mean_plddt": 73.9, "plddt_band": "Confident (70–90)", "n_residues": 1447, "local_pdb": "digital_twin\\data\\structures\\Q13635_AF.pdb" }, "uniprot": "Q13635", "uniprot_name": "Protein patched homolog 1", "length": 1447, "function": "Acts as a receptor for sonic hedgehog (SHH), indian hedgehog (IHH) and desert hedgehog (DHH). Associates with the smoothened protein (SMO) to transduce the hedgehog's proteins signal. Seems to have a tumor suppressor function, as inactivation of this protein is probably a necessary, if not sufficient step for tumorigenesis", "pdb_count": 16, "pdb_ids": [ "6DMB", "6DMO", "6DMY", "6E1H", "6N7G", "6N7H", "6N7K", "6OEU" ], "grounding": [ { "paper": "Mice with a Targeted Mutation of Patched2 Are Viable but Develop Alopecia and Epidermal Hyperplasia†", "quote": "). Ptc1 mutations also occur in sporadic forms of BCC and MB. Mutational studies with mice have verified that Ptc1 is a tumor suppressor. We previously identified a second mammalian Patched gene, Ptc2, and demonstrated its distinct expression pattern during embryogenesis, suggesting a unique role in d", "n_hits": 34 }, { "paper": "Skin cancer understanding the journey of transformation from conventional to advanced treatment approaches.", "quote": "unity not able to cope with the cancer- inducing agents, (iii) beta human papilloma virus (HPV) and (iv) Human immunodeficiency virus (HIV) [51]. Cell growth is regulated by the patched/hedgehog intracel- lular signaling system, and continuous activation of this pathway results in the formation of B", "n_hits": 10 }, { "paper": "Molecular signatures and signaling interactions of the hair follicle stem cell niche.", "quote": "h→Hhip, which inhibits Hedgehog signaling by SHH sequestering (Griffiths et al., 2021). Conversely, in a Shh→Gpc5 interaction, Gpc5 may promote Hedgehog signaling by stabilizing Ptch1 binding (Li et al., 2011). Potential interaction calls from DP to BuSCs included all four R- spondins, highly expres", "n_hits": 6 }, { "paper": "Ox40-Cre–mediated deletion of BRD4 reveals an unexpected phenotype of hair follicle stem cells in alopecia", "quote": "CAGTC CACAGTCTTGTCAATCTTGGCA Cdca2 CGAGTTCACACGACAAGCCT GGAGTCACAAACGGTTCAGTTC Cdk4 ATGGCTGCCACTCGATATGAA TCCTCCATTAGGAACTCTCACAC Ccnd1 GCGTACCCTGACACCAATCTC CTCCTCTTCGCACTTCTGCTC Ptch1 AAAGAACTGCGGAAGTTTTTG CTTCTCCTATCTTCTGACGGGT Gas1 CCATCTGCGAATCGGTCAAAG GCTCGTCGTCATATTCTTCGTC Gli1 CCAAGCCAACTTTA", "n_hits": 2 } ], "grounded_in_corpus": true }, { "gene": "PTEN", "name": "Phosphatase and tensin homolog", "diseases": [ "AGA" ], "pathway": "PI3K-AKT-mTOR", "twin_node": "APO", "effect": "-", "role": "protector", "drugs": [], "mechanism": "autophagy 유지로 DP apoptosis 억제(보호인자); CRH 가 PTEN 을 억제하면 apoptosis↑.", "evidence_paper_ids": [], "n_evidence": 0, "mention_count": 0, "sources": [ "discover:AGA", "discover:HFSC", "seed" ], "in_model": true, "uncertain": false, "structure": { "accession": "P60484", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/P60484", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-P60484-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-P60484-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/P60484", "mean_plddt": 83.0, "plddt_band": "Confident (70–90)", "n_residues": 403, "local_pdb": "digital_twin\\data\\structures\\P60484_AF.pdb" }, "uniprot": "P60484", "uniprot_name": "Phosphatidylinositol 3,4,5-trisphosphate 3-phosphatase and dual-specificity protein phosphatase PTEN", "length": 403, "function": "Dual-specificity protein phosphatase, dephosphorylating tyrosine-, serine- and threonine-phosphorylated proteins (PubMed:9187108, PubMed:9256433, PubMed:9616126). Also functions as a lipid phosphatase, removing the phosphate in the D3 position of the inositol ring of PtdIns(3,4,5)P3/phosphatidylinositol 3,4,5-trisphosphate, PtdIns(3,4)P2/phosphatidylinositol 3,4-diphosphate and PtdIns3P/phosphatidylinositol 3-phosphate with a preference for PtdIns(3,4,5)P3 (PubMed:16824732, PubMed:26504226, PubMed:9593664, PubMed:9811831). Furthermore, this enzyme can also act as a cytosolic inositol 3-phospha", "pdb_count": 12, "pdb_ids": [ "1D5R", "2KYL", "4O1V", "5BUG", "5BZX", "5BZZ", "7JTX", "7JUK" ], "grounding": [ { "paper": "Corticotropin-releasing hormone inhibits autophagy by suppressing PTEN to promote apoptosis in dermal papilla cells", "quote": "Research Article Annals of Medicine 2025, VOL. 57, NO. 1, 2490823 Corticotropin-releasing hormone inhibits autophagy by suppressing PTEN to promote apoptosis in dermal papilla cells Wenzi Lianga, Xiuwen Chenb, Na Nic, Chutong Zhuangc, Zhiying Yua, Ziqing Xua, Yingshi Lia, Changmin Lina and Keng Huan", "n_hits": 84 }, { "paper": "ISEV2025 Abstract Book.", "quote": "viron- ment. OF11.3 Delivery of melanoma cell-derived miR-92b-3p by extracellular vesicles promotes the formation of carcinoma-associated fibroblasts through the downregulation of PTEN Stefanie Kewitz-Hempel1, Nicola Windisch1, Gerd Hause2, Lutz Müller3, Cord Sunderkötter1, Dennis Gerloff1 1Departme", "n_hits": 18 }, { "paper": "Skin cancer understanding the journey of transformation from conventional to advanced treatment approaches.", "quote": "pathway predominantly facilitates proliferation and invasion. One of the inhibi- tors of the PI3K pathway is the enzyme phosphatase and tensing homolog deleted on chromosome 10 (PTEN). PTEN catalyzes the de-phosphorylation reaction of phosphatidylinositol 3,4,5-trisphosphate (PIP3) back to phosphati", "n_hits": 11 } ], "grounded_in_corpus": true }, { "gene": "PTGDR2", "name": "Prostaglandin D2 receptor 2 (CRTH2/GPR44)", "diseases": [ "AGA" ], "pathway": "Prostaglandin", "twin_node": "APO", "effect": "+", "role": "driver", "drugs": [ "fevipiprant", "fevipiprant (repurposing)", "ramatroban", "setipiprant", "setipiprant (CRTH2 antagonist, trialed for AGA)", "setipiprant (Phase 2)" ], "mechanism": "PGD2 수용체; 모낭 소형화 매개.", "evidence_paper_ids": [], "n_evidence": 0, "mention_count": 0, "sources": [ "discover:AGA", "discover:recent", "seed" ], "in_model": true, "uncertain": false, "structure": { "accession": "Q9Y5Y4", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/Q9Y5Y4", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-Q9Y5Y4-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-Q9Y5Y4-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/Q9Y5Y4", "mean_plddt": 81.0, "plddt_band": "Confident (70–90)", "n_residues": 395, "local_pdb": "digital_twin\\data\\structures\\Q9Y5Y4_AF.pdb" }, "uniprot": "Q9Y5Y4", "uniprot_name": "Prostaglandin D2 receptor 2", "length": 395, "function": "Receptor for prostaglandin D2 (PGD2). Coupled to the G(i)-protein. Receptor activation may result in pertussis toxin-sensitive decreases in cAMP levels and Ca(2+) mobilization. PI3K signaling is also implicated in mediating PTGDR2 effects. PGD2 induced receptor internalization. CRTH2 internalization can be regulated by diverse kinases such as, PKC, PKA, GRK2, GPRK5/GRK5 and GRK6. Receptor activation is responsible, at least in part, in immune regulation and allergic/inflammation responses", "pdb_count": 6, "pdb_ids": [ "6D26", "6D27", "7M8W", "8XXU", "8XXV", "9IYB" ], "grounding": [ { "paper": "Use of genetics in the prediction of success in male pattern hair loss therapy and mechanistic studies.", "quote": "y (Heilmann-Heimbach et al., 2017; Michel et al., 2017; Li et al., 2024). Functional studies of bald versus non-bald scalp confirm that prostaglandin D2 (PGD2) and its receptor GPR44 are upregulated in balding areas and that PGD2 directly inhibits hair growth, while prostaglandin F2α analogues, acti", "n_hits": 17 }, { "paper": "Prostaglandin D2 Inhibits Hair Growth and Is Elevated in Bald Scalp of Men with Androgenetic Alopecia", "quote": "H, Hirai H, Nagata K, Hara T, Utsuyama M, Hirokawa K, Sugamura K, Nishioka K, Nakamura M. Prostaglandin D2 plays an essential role in chronic allergic inflammation of the skin via CRTH2 receptor. J Immunol. 2006; 177:2621–2629. [PubMed: 16888024] 27. Eguchi N, Minami T, Shirafuji N, Kanaoka Y, Tanak", "n_hits": 16 }, { "paper": "The Genetic Landscape of Androgenetic Alopecia Current Knowledge and Future Perspectives.", "quote": "sex population Increased risk ACE [33] rs4343 Mixed ethnicity and mixed sex population Increased risk PTGFR [33] rs10782665 Mixed ethnicity and mixed sex population Increased risk PTGDR2 [33] rs533116 Mixed male and female population Increased risk rs545659 Mixed ethnicity and mixed sex population I", "n_hits": 2 } ], "grounded_in_corpus": true }, { "gene": "RIPK1", "name": "Receptor-interacting protein kinase 1", "diseases": [ "AA" ], "pathway": "Necroptosis", "twin_node": "APO", "effect": "+", "role": "driver", "drugs": [ "RIPK1 inhibitor", "RIPK1 inhibitors (investigational)" ], "mechanism": "모낭세포 necroptosis 매개.", "evidence_paper_ids": [], "n_evidence": 0, "mention_count": 0, "sources": [ "discover:AA", "seed" ], "in_model": true, "uncertain": false, "structure": { "accession": "Q13546", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/Q13546", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-Q13546-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-Q13546-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/Q13546", "mean_plddt": 69.7, "plddt_band": "Low (50–70)", "n_residues": 671, "local_pdb": "digital_twin\\data\\structures\\Q13546_AF.pdb" }, "uniprot": "Q13546", "uniprot_name": "Receptor-interacting serine/threonine-protein kinase 1", "length": 671, "function": "Serine-threonine kinase which is a key regulator of TNF-mediated apoptosis, necroptosis and inflammatory pathways (PubMed:17703191, PubMed:24144979, PubMed:31827280, PubMed:31827281, PubMed:32657447, PubMed:35831301). Exhibits kinase activity-dependent functions that regulate cell death and kinase-independent scaffold functions regulating inflammatory signaling and cell survival (PubMed:11101870, PubMed:19524512, PubMed:19524513, PubMed:29440439, PubMed:30988283). Has kinase-independent scaffold functions: upon binding of TNF to TNFR1, RIPK1 is recruited to the TNF-R1 signaling complex (TNF-RS", "pdb_count": 26, "pdb_ids": [ "4ITH", "4ITI", "4ITJ", "4NEU", "5HX6", "5TX5", "5V7Z", "6AC5" ], "grounding": [ { "paper": "The Involvement of RIPK1 in Alopecia Areata", "quote": "Revised: 6 February 2025 Accepted: 10 February 2025 Published: 13 February 2025 Citation: Kim, H.; Zheng, M.; An, S.; Park, I.G.; Song, L.; Noh, M.; Sung, J.-H. The Involvement of RIPK1 in Alopecia Areata. Int. J. Mol. Sci. 2025, 26, 1565. https://doi.org/10.3390/ ijms26041565 Copyright: © 2025 by t", "n_hits": 87 } ], "grounded_in_corpus": true }, { "gene": "SMAD3", "name": "Mothers against decapentaplegic homolog 3", "diseases": [ "CIA" ], "pathway": "BMP/TGFβ", "twin_node": "APO", "effect": "+", "role": "driver", "drugs": [ "SIS3 (SMAD3 inhibitor, experimental)" ], "mechanism": "TGFβ 하류; keratin 억제·apoptosis.", "evidence_paper_ids": [], "n_evidence": 0, "mention_count": 0, "sources": [ "discover:CIA", "seed" ], "in_model": true, "uncertain": false, "structure": { "accession": "P84022", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/P84022", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-P84022-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-P84022-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/P84022", "mean_plddt": 83.6, "plddt_band": "Confident (70–90)", "n_residues": 425, "local_pdb": "digital_twin\\data\\structures\\P84022_AF.pdb" }, "uniprot": "P84022", "uniprot_name": "SMAD family member 3", "length": 425, "function": "Receptor-regulated SMAD (R-SMAD) that is an intracellular signal transducer and transcriptional modulator activated by TGF-beta (transforming growth factor) and activin type 1 receptor kinases. Binds the TRE element in the promoter region of many genes that are regulated by TGF-beta and, on formation of the SMAD3/SMAD4 complex, activates transcription. Also can form a SMAD3/SMAD4/JUN/FOS complex at the AP-1/SMAD site to regulate TGF-beta-mediated transcription. Has an inhibitory effect on wound healing probably by modulating both growth and migration of primary keratinocytes and by altering th", "pdb_count": 12, "pdb_ids": [ "1MHD", "1MJS", "1MK2", "1OZJ", "1U7F", "2LAJ", "2LB2", "5OD6" ], "grounding": [ { "paper": "Kartogenin regulates hair growth and hair cycling", "quote": "ch the transforming growth factor (TGF)-β2 is crucial [19-21]. TGF-β2, which is a multifunctional cytokine, propagates signals via TGF-β receptor and phosphorylating Smad2 and Smad3 [22]. Various studies demonstrated that TGF-β2 is a catagen phase inducer and inhibition of TGF-β2 activity during hai", "n_hits": 45 }, { "paper": "iTRAQ-based quantitative proteomics revealing the therapeutic mechanism of a medicinal and edible formula YH0618 in reducing doxorubicin-induced alopecia by targeting and TGF-b Smad3 pathway", "quote": "d quantitative proteomics revealing the therapeutic mechanism of a medicinal and edible formula YH0618 in reducing doxorubicin-induced alopecia by targeting keratins and TGF-β/ Smad3 pathway Renkai Li a,b,1, Mingxia Chen a,1, Danxi Yan a, Liang Chen c, Mandi Lin d, Bohui Deng a, Likai Zhuang a, Fei ", "n_hits": 35 }, { "paper": "iTRAQ-based quantitative proteomics revealing the therapeutic mechanism of a medicinal and edible formula YH0618 in reducing doxorubicin-induced alopecia by targeting keratins and TGF-β Smad3 pathway", "quote": "d quantitative proteomics revealing the therapeutic mechanism of a medicinal and edible formula YH0618 in reducing doxorubicin-induced alopecia by targeting keratins and TGF-β/ Smad3 pathway Renkai Li a,b,1, Mingxia Chen a,1, Danxi Yan a, Liang Chen c, Mandi Lin d, Bohui Deng a, Likai Zhuang a, Fei ", "n_hits": 35 }, { "paper": "Deletion of hypoxia-inducible factor prolyl 4-hydroxylase 2 in FoxD1-lineage mesenchymal cells leads to congenital truncal alopecia", "quote": "rophages is associated with TGFβ1-induced plasminogen activator inhibitor 1 production and is reversibly inhibited by HIF1α silencing (66). Hypoxia also affects directly the SMAD2–SMAD3 complex by enhancing its transfer to the nucleus in human dermal fibroblasts and subsequently drives them into tran", "n_hits": 6 } ], "grounded_in_corpus": true }, { "gene": "SOCS3", "name": "Suppressor of cytokine signaling 3", "diseases": [ "AA" ], "pathway": "JAK-STAT", "twin_node": "INF", "effect": "-", "role": "protector", "drugs": [ "SOCS3 mimetic" ], "mechanism": "JAK-STAT 음성 피드백; 처리 시 AA 예방.", "evidence_paper_ids": [], "n_evidence": 0, "mention_count": 0, "sources": [ "discover:AA", "seed" ], "in_model": true, "uncertain": false, "structure": { "accession": "O14543", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/O14543", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-O14543-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-O14543-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/O14543", "mean_plddt": 71.9, "plddt_band": "Confident (70–90)", "n_residues": 225, "local_pdb": "digital_twin\\data\\structures\\O14543_AF.pdb" }, "uniprot": "O14543", "uniprot_name": "Suppressor of cytokine signaling 3", "length": 225, "function": "SOCS family proteins form part of a classical negative feedback system that regulates cytokine signal transduction. SOCS3 is involved in negative regulation of cytokines that signal through the JAK/STAT pathway. Inhibits cytokine signal transduction by binding to tyrosine kinase receptors including IL6ST/gp130, LIF, erythropoietin, insulin, IL12, GCSF and leptin receptors. Binding to JAK2 inhibits its kinase activity and regulates IL6 signaling. Suppresses fetal liver erythropoiesis. Regulates onset and maintenance of allergic responses mediated by T-helper type 2 cells (By similarity). Probab", "pdb_count": 0, "pdb_ids": [], "grounding": [ { "paper": "SOCS3 treatment prevents the development of alopecia areata by inhibiting CD8+ T cell-mediated autoimmune destruction", "quote": "Oncotarget 33432 www.impactjournals.com/oncotarget SOCS3 treatment prevents the development of alopecia areata by inhibiting CD8+ T cell-mediated autoimmune destruction Zhen Gao1, Yu-Qing Jin2, Wei Wu1 1Department of Plastic and Recons", "n_hits": 144 }, { "paper": "JAK-STAT1 as therapeutic target for EGFR deficiency-associated inflammation and scarring alopecia", "quote": "g hub, including downstream effectors (e.g., interferon induced genes: Ifi47, Ifi214, and Ifitm3) and the downregulation of its negative regulator suppressor of cytokine signaling 3 (Socs3; Fig. 3B, first panel). SOCS3 protein reduction could also be visualized in the hair follicles from skin sections f", "n_hits": 8 } ], "grounded_in_corpus": true }, { "gene": "SRD5A1", "name": "Steroid 5-alpha-reductase 1", "diseases": [ "AGA" ], "pathway": "Androgen signaling", "twin_node": "AND", "effect": "+", "role": "driver", "drugs": [ "dutasteride", "finasteride (weak)" ], "mechanism": "테스토스테론→DHT 전환 효소 (type 1).", "evidence_paper_ids": [], "n_evidence": 0, "mention_count": 0, "sources": [ "discover:AGA", "seed" ], "in_model": true, "uncertain": false, "structure": { "accession": "P18405", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/P18405", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-P18405-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-P18405-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/P18405", "mean_plddt": 91.5, "plddt_band": "Very high (≥90)", "n_residues": 259, "local_pdb": "digital_twin\\data\\structures\\P18405_AF.pdb" }, "uniprot": "P18405", "uniprot_name": "3-oxo-5-alpha-steroid 4-dehydrogenase 1", "length": 259, "function": "Converts testosterone into 5-alpha-dihydrotestosterone and progesterone or corticosterone into their corresponding 5-alpha-3-oxosteroids. It plays a central role in sexual differentiation and androgen physiology", "pdb_count": 0, "pdb_ids": [], "grounding": [ { "paper": "Use of genetics in the prediction of success in male pattern hair loss therapy and mechanistic studies.", "quote": "Chen et al., 2025; Liu et al., 2025b). Our recent work using pharmacogenetic panels has started to link specific single-nucleotide polymorphisms (SNPs) in genes such as SULT1A1, SRD5A1, SRD5A2, PTGES2, and PTGFR to differential responses to minoxidil and 5α-reductase inhibitors, and to patterns of n", "n_hits": 20 } ], "grounded_in_corpus": true }, { "gene": "SRD5A3", "name": "Polyprenol reductase (5-alpha-reductase 3)", "diseases": [ "AGA" ], "pathway": "Androgen signaling", "twin_node": "AND", "effect": "+", "role": "modulator", "drugs": [ "dutasteride (partial)" ], "mechanism": "보조적 5α-환원 활성.", "evidence_paper_ids": [], "n_evidence": 0, "mention_count": 0, "sources": [ "discover:AGA", "seed" ], "in_model": true, "uncertain": false, "structure": { "accession": "Q9H8P0", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/Q9H8P0", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-Q9H8P0-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-Q9H8P0-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/Q9H8P0", "mean_plddt": 88.4, "plddt_band": "Confident (70–90)", "n_residues": 318, "local_pdb": "digital_twin\\data\\structures\\Q9H8P0_AF.pdb" }, "uniprot": "Q9H8P0", "uniprot_name": "Polyprenal reductase", "length": 318, "function": "Plays a key role in early steps of protein N-linked glycosylation by being involved in the conversion of polyprenol into dolichol (PubMed:20637498, PubMed:38821050). Acts as a polyprenal reductase that mediates the reduction of polyprenal into dolichal in a NADP-dependent mechanism (PubMed:38821050). Dolichols are required for the synthesis of dolichol-linked monosaccharides and the oligosaccharide precursor used for N-glycosylation (PubMed:20637498, PubMed:38821050). Also able to convert testosterone (T) into 5-alpha-dihydrotestosterone (DHT) (PubMed:17986282, PubMed:26855069)", "pdb_count": 0, "pdb_ids": [], "grounding": [], "grounded_in_corpus": false }, { "gene": "STAT5A", "name": "Signal transducer STAT5A", "diseases": [ "AA" ], "pathway": "JAK-STAT", "twin_node": "INF", "effect": "+", "role": "driver", "drugs": [], "mechanism": "IL-15 하류 effector.", "evidence_paper_ids": [], "n_evidence": 0, "mention_count": 0, "sources": [ "discover:AA", "seed" ], "in_model": true, "uncertain": false, "structure": { "accession": "P42229", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/P42229", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-P42229-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-P42229-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/P42229", "mean_plddt": 85.1, "plddt_band": "Confident (70–90)", "n_residues": 794, "local_pdb": "digital_twin\\data\\structures\\P42229_AF.pdb" }, "uniprot": "P42229", "uniprot_name": "Signal transducer and activator of transcription 5A", "length": 794, "function": "Carries out a dual function: signal transduction and activation of transcription. Mediates cellular responses to the cytokine KITLG/SCF and other growth factors. Mediates cellular responses to ERBB4. May mediate cellular responses to activated FGFR1, FGFR2, FGFR3 and FGFR4. Binds to the GAS element and activates PRL-induced transcription. Regulates the expression of milk proteins during lactation", "pdb_count": 5, "pdb_ids": [ "7TVA", "7TVB", "7UBT", "7UC6", "7UC7" ], "grounding": [ { "paper": "Induction of T cell exhaustion by JAK1 3 inhibition in the treatment of alopecia areata", "quote": "STAT signaling in mouse T cells by treatment with Ifidancitinib. We found that treatment of mouse T cells with Ifidancitinib over a range of doses strongly inhibited IL-2-stimulated STAT5 phosphorylation (Figure 1A). Ifidancitinib also exhibited potent inhibitory effects on JAK1/2-mediated IFN-g signal", "n_hits": 8 }, { "paper": "Selective Janus kinase 1 inhibition resolves inflammation and restores hair growth offering a viable treatment option for alopecia areata", "quote": "sur- vival signals between CD8+ T cells residing at the two sites. Long term survival of memory CD8+ T cells is dependent on IL‐15 and IL‐7, both of which signal via JAK1/JAK3 and STAT5 to induce anti‐apoptotic mole- cules such as Bcl‐2 or BclXL.61–63 Blocking IL‐15RB has been shown to be efficient ", "n_hits": 5 }, { "paper": "Blockade of IL-7 signaling suppresses inflammatory responses and reverses alopecia areata in C3H HeJ mice", "quote": "l control scalp skin (Fig. 1, E and F). We investigated the effects of IL-7–mediated signaling in skin-­ infiltrating T cells. Signal transducer and activator of transcription 5 (STAT5) is a key transcription factor downstream of IL-7R, and IL-7 requires STAT5 to induce Bcl-2 expression and to main", "n_hits": 4 }, { "paper": "Skin cancer understanding the journey of transformation from conventional to advanced treatment approaches.", "quote": "pathway that is directly connected to the family of proteins called JAK (Janus Kinase) which is involved in the integration of different signaling path- way’s signals. STAT3 and STAT5 are majorly involved in the progression of cancer while STAT1 plays a crucial role in tumor suppression. Chronic inf", "n_hits": 4 } ], "grounded_in_corpus": true }, { "gene": "TBX21", "name": "T-box transcription factor TBX21 (T-bet)", "diseases": [ "AA" ], "pathway": "JAK-STAT", "twin_node": "INF", "effect": "+", "role": "driver", "drugs": [ "T-bet siRNA" ], "mechanism": "Th1/IFNγ 분화 마스터 전사인자.", "evidence_paper_ids": [], "n_evidence": 0, "mention_count": 0, "sources": [ "discover:AA", "seed" ], "in_model": true, "uncertain": false, "structure": { "accession": "Q9UL17", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/Q9UL17", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-Q9UL17-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-Q9UL17-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/Q9UL17", "mean_plddt": 60.9, "plddt_band": "Low (50–70)", "n_residues": 535, "local_pdb": "digital_twin\\data\\structures\\Q9UL17_AF.pdb" }, "uniprot": "Q9UL17", "uniprot_name": "T-box transcription factor TBX21", "length": 535, "function": "Lineage-defining transcription factor which initiates Th1 lineage development from naive Th precursor cells both by activating Th1 genetic programs and by repressing the opposing Th2 and Th17 genetic programs (PubMed:10761931). Activates transcription of a set of genes important for Th1 cell function, including those encoding IFN-gamma and the chemokine receptor CXCR3. Induces permissive chromatin accessibilty and CpG methylation in IFNG (PubMed:33296702). Activates IFNG and CXCR3 genes in part by recruiting chromatin remodeling complexes including KDM6B, a SMARCA4-containing SWI/SNF-complex, ", "pdb_count": 0, "pdb_ids": [], "grounding": [ { "paper": "Controlled Delivery of T-box21 Small Interfering RNA Ameliorates Autoimmune Alopecia (Alopecia Areata) in a C3H HeJ Mouse Model", "quote": "using cationized gelatin8 as a new therapeutic approach, targeting T- box21 gene (Tbx21) to repress the expression of inter- feron-\u0001 gene (Ifng). Tbx21 gene was formerly known as T-bet gene and plays an important role in control of the Ifng gene expression and Th1 cell differentiation and function.9", "n_hits": 120 }, { "paper": "The C3H HeJ mouse and DEBR rat models for alopecia areata review of preclinical drug screening approaches and results", "quote": "mouse recombinant IL4 were given daily for 3 weeks which significantly restored hair growth which persisted during the 2 month observation period (18). Gene therapy with T-box 21 (Tbx21) T-box 21 is a transcription factor involved in Th1 differentiation, the dominant immunological process in AA as m", "n_hits": 27 }, { "paper": "Blockade of IL-7 signaling suppresses inflammatory responses and reverses alopecia areata in C3H HeJ mice", "quote": "models (20, 21), IL-7c increased the total number of lymphocytes in lymphoid organs (fig. S3A). We also found that IL-7c robustly increased the frequency of CXCR3+CD8+ T cells, T-bet+CD8+ T cells, and IFN-–producing CD8+ T cells in SDLNs (Fig. 2I and fig. S3B) but only slightly in- creased the freq", "n_hits": 4 }, { "paper": "TH1 effector CD4 T cells rely on IFN-γ production to induce alopecia areata", "quote": "tiva- tion including Cd44, Pdcd1, Icos, and Ctla4 (Fig. 3C). We also found several genes with increased expression relating to TH1 differentia- tion and function including Stat4, Tbx21, Stat1, Ifng, Il18r1, Il12rb1, and Cxcr3 (Fig. 3C). We next used the decoupleR package to infer TF activity. We com", "n_hits": 4 } ], "grounded_in_corpus": true }, { "gene": "TYK2", "name": "Non-receptor tyrosine-protein kinase TYK2", "diseases": [ "AA" ], "pathway": "JAK-STAT", "twin_node": "INF", "effect": "+", "role": "driver", "drugs": [ "deucravacitinib", "ritlecitinib (PLCG2/JAK3 dual)" ], "mechanism": "IL-12/23·I형 IFN 신호.", "evidence_paper_ids": [], "n_evidence": 0, "mention_count": 0, "sources": [ "discover:AA", "seed" ], "in_model": true, "uncertain": false, "structure": { "accession": "P29597", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/P29597", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-P29597-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-P29597-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/P29597", "mean_plddt": 81.8, "plddt_band": "Confident (70–90)", "n_residues": 1187, "local_pdb": "digital_twin\\data\\structures\\P29597_AF.pdb" }, "uniprot": "P29597", "uniprot_name": "Non-receptor tyrosine-protein kinase TYK2", "length": 1187, "function": "Tyrosine kinase of the non-receptor type involved in numerous cytokines and interferons signaling, which regulates cell growth, development, cell migration, innate and adaptive immunity (PubMed:10542297, PubMed:10995743, PubMed:7657660, PubMed:7813427, PubMed:8232552). Plays both structural and catalytic roles in numerous interleukins and interferons (IFN-alpha/beta) signaling (PubMed:10542297). Associates with heterodimeric cytokine receptor complexes and activates STAT family members including STAT1, STAT3, STAT4 or STAT6 (PubMed:10542297, PubMed:7638186). The heterodimeric cytokine receptor", "pdb_count": 52, "pdb_ids": [ "3LXN", "3LXP", "3NYX", "3NZ0", "3ZON", "4GFO", "4GIH", "4GII" ], "grounding": [ { "paper": "Selective Janus kinase 1 inhibition resolves inflammation and restores hair growth offering a viable treatment option for alopecia areata", "quote": "scribed increased risk of respiratory infections due to the immunosuppressive effects following long term use. The safety profile for Baricitinib (10 and 100‐fold selectivity over TYK2 and JAK3, respectively30) in AA was recently presented to be similar to that found in RA and AD31 (Press release ht", "n_hits": 12 }, { "paper": "JAK-centric explainable few-shot gene-expression diagnosis framework for alopecia via MultiPLIER priors and relation-style set-to-set comparison.", "quote": "s, a Comprehensive differential expression analysis of key genes was conducted in the AGA dataset. Particular emphasis was placed on the JAK family genes (JAK1, JAK2, JAK3, and TYK2), then the differential expression of these genes in AGA was analyzed to clarify their potential mechanisms in this di", "n_hits": 10 }, { "paper": "Selective inhibition of JAK3 signaling is sufficient to reverse alopecia areata", "quote": "d that INCB039110 and PF-06651600 (but not CEP- 33779) robustly inhibited this response (Figure 1, A and B). Next, we used IL-10 to induce STAT3 tyrosine phosphorylation via JAK1/TYK2 and found that it was specifically inhibited by INCB039110 (Figure 1C). In primary mouse macrophages, we observed th", "n_hits": 8 }, { "paper": "JAK-STAT1 as therapeutic target for EGFR deficiency-associated inflammation and scarring alopecia", "quote": "ntation WT Psmb10 Psmb8 Psmb9 Rpn1 Rpn2 Hspd1 Hspe1 Immunoproteasome -1 0 1 Osmr Il10rb Il11ra1 Il11ra2 Il13ra1 Il20rb Il4ra Il6ra Il6st Ifngr1 Ifngr2 Ifnar1 Ifnar2 Jak1 Jak2 Jak3 Tyk2 Stat1 Stat3 Stat4 Stat5a Stat5b Ifi214 Ifi47 Ifitm3 Socs3 JAK-STAT Pathway 0 20 40 60 80 ** **** ** **** **** *** *", "n_hits": 2 } ], "grounded_in_corpus": true }, { "gene": "WNT10B", "name": "Protein Wnt-10b", "diseases": [ "AGA" ], "pathway": "Wnt/β-catenin", "twin_node": "Wnt", "effect": "+", "role": "protector", "drugs": [ "Wnt mimetics (investigational)" ], "mechanism": "모낭 재생 개시 Wnt 리간드.", "evidence_paper_ids": [], "n_evidence": 0, "mention_count": 0, "sources": [ "discover:AGA", "seed" ], "in_model": true, "uncertain": false, "structure": { "accession": "O00744", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/O00744", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-O00744-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-O00744-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/O00744", "mean_plddt": 80.1, "plddt_band": "Confident (70–90)", "n_residues": 389, "local_pdb": "digital_twin\\data\\structures\\O00744_AF.pdb" }, "uniprot": "O00744", "uniprot_name": "Protein Wnt-10b", "length": 389, "function": "Member of the Wnt ligand gene family that encodes for secreted proteins, which activate the Wnt signaling cascade. Specifically activates canonical Wnt/beta-catenin signaling and thus triggers beta-catenin/LEF/TCF-mediated transcriptional programs. Involved in signaling networks controlling stemness, pluripotency and cell fate decisions. Acts in the immune system, mammary gland, adipose tissue, bone and skin", "pdb_count": 0, "pdb_ids": [], "grounding": [ { "paper": "Subcutaneous injection of genetically engineered exosomes for androgenic alopecia treatment", "quote": "tifunctional exosome-based targeted delivery platform, designated as EX104, through the engineering of HEK-293 cells to express a combination of therapeutical molecules, including WNT10B, VEGFA, and FGF7. EX104 reversed the hair follicle miniaturization phenotype in DHT-induced DPCs. Furthermore, it", "n_hits": 16 }, { "paper": "Vinegar‐Processed Black Soybean Promotes Hair Growth and Prevents Alopecia via Wnt β‐Catenin Pathway", "quote": "18 days. Outcomes were evaluated via trichogram scoring, hair length and weight analysis, histomorphometric evaluation, and Western blot quantification of β-­ catenin, GSK3β, and Wnt10b expression. To assess antialopecia effects, cyclophosphamide (100 mg·kg−1) was intraperito- neally administered on", "n_hits": 11 }, { "paper": "Pilose antler extracts promotes hair growth in androgenetic alopecia mice by activating hair follicle stem cells via the AKT and Wnt pathways", "quote": "p-GSK3β-Ser9 (rabbit, Abclonal, AP1088, 1: 2000), GSK3β (rabbit, Abclonal, A11731, 1:2000), β-catenin (rabbit, Abclonal, A19657, 1:2000), WNT3A (rabbit, Abclonal, A0642, 1:2000), WNT10B (rabbit, Abclonal, A16717, 1:2000). 2.9 RT-qPCR Total RNA was obtained using the extract kit. Subsequently, the Ma", "n_hits": 8 }, { "paper": "Dissolvable microneedles loaded ginsenoside Rg3 liposome a transdermal delivery approach for alopecia treatment", "quote": "higher. Furthermore, quantitative character­ ization and transcriptome sequencing results showed that Rg3-MNs promoted hair regeneration by promoting the expression of Wnt3a and Wnt10b genes, activating the Wnt/β-catenin pathway. Therefore, Rg3-MNs present broad prospects in the treatment of alopeci", "n_hits": 6 } ], "grounded_in_corpus": true }, { "gene": "WNT3A", "name": "Protein Wnt-3a", "diseases": [ "AGA", "CIA" ], "pathway": "Wnt/β-catenin", "twin_node": "Wnt", "effect": "+", "role": "protector", "drugs": [ "WNT agonists / GSK3 inhibitors (experimental)", "recombinant WNT3A / Wnt mimetics (investigational)" ], "mechanism": "β-catenin 안정화 리간드.", "evidence_paper_ids": [], "n_evidence": 0, "mention_count": 0, "sources": [ "discover:AGA", "discover:CIA", "seed" ], "in_model": true, "uncertain": false, "structure": { "accession": "P56704", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/P56704", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-P56704-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-P56704-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/P56704", "mean_plddt": 88.3, "plddt_band": "Confident (70–90)", "n_residues": 352, "local_pdb": "digital_twin\\data\\structures\\P56704_AF.pdb" }, "uniprot": "P56704", "uniprot_name": "Protein Wnt-3a", "length": 352, "function": "Ligand for members of the frizzled family of seven transmembrane receptors (Probable). Functions in the canonical Wnt signaling pathway that results in activation of transcription factors of the TCF/LEF family (PubMed:20093360, PubMed:21244856, PubMed:24841207, PubMed:26902720). Required for normal embryonic mesoderm development and formation of caudal somites. Required for normal morphogenesis of the developing neural tube (By similarity). Mediates self-renewal of the stem cells at the bottom on intestinal crypts (in vitro) (PubMed:26902720)", "pdb_count": 4, "pdb_ids": [ "7DRT", "7URD", "7URE", "8TZR" ], "grounding": [ { "paper": "Periplaneta americana extract (L.) promotes hair regrowth in Alopecia areata mice by reducing inflammation and modulating skin microbiota", "quote": "iferation and hair growth in AA mice, reduced skin TNF-α, IL-23, and VCAM-1 expression. Transcriptomics and WB analysis indicated PA-011 downregulated inflammatory genes, activated Wnt3a, and modulated the TGF-β pathway. Metabolomics found PA-011 regulated metabolic pathways. 16S rRNA analysis showed", "n_hits": 11 }, { "paper": "Curcumin-primed milk-derived extracellular vesicles remodel hair follicle microenvironment for the treatment of androgenetic alopecia", "quote": "1224), all obtained from Proteintech Group, Inc.; Ki67 (GB121141), SOX9 (GB14171), IL-6 (GB11117), and TNF-α (GB11188), which were obtained from Servicebio Technology Co., Ltd; Wnt3a (DF6113) was purchased from Affinity Biosciences Group, Ltd. Isolation of mEVs AA was added to defatted bovine milk a", "n_hits": 10 }, { "paper": "Exploring the Efficacy and Potential Mechanisms of Topical Periplaneta americana (L.) Extract in Treating Androgenetic Alopecia in a Mouse Model A Systems Pharmacology and Skin Microbiome Analysis", "quote": "ology, PG212, Shanghai, China) were purchased from technology companies. The primary antibodies used included β-actin (mouse-derived, GB12001), Wnt7a (rabbit-derived, A14194), and Wnt3a (rabbit-derived, A0642) (Abclonal, Wuhan, China). Primers for genes GAPDH, Akt, Wnt7a, and β-catenin were synthesi", "n_hits": 9 }, { "paper": "ISEV2025 Abstract Book.", "quote": "man primary cells, suggesting a promising strategy against reducing ageing hallmarks in age-associated diseases, particularly those driven by accumulating senescent cells. PS1.153 WNT3A-loaded bi-layered microwell scaffolds enhance stemness and extracellular vesicle production in salivary gland stem", "n_hits": 9 } ], "grounded_in_corpus": true }, { "gene": "ABCB1", "name": "ATP-binding cassette subfamily B member 1 (P-glycoprotein)", "diseases": [ "CIA" ], "pathway": "Other", "twin_node": "—", "effect": "?", "role": "protector", "drugs": [], "mechanism": "ABC efflux transporters, induced by phenobarbital, expel chemotherapeutic agents from hair follicles to protect against chemotherapy-induced alopecia.", "evidence_paper_ids": [ "41587585" ], "n_evidence": 1, "mention_count": 0, "sources": [ "extract" ], "in_model": false, "uncertain": true, "structure": { "accession": "P08183", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/P08183", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-P08183-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-P08183-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/P08183", "mean_plddt": 84.6, "plddt_band": "Confident (70–90)", "n_residues": 1280, "local_pdb": "digital_twin\\data\\structures\\P08183_AF.pdb" }, "uniprot": "P08183", "uniprot_name": "ATP-dependent translocase ABCB1", "length": 1280, "function": "Translocates drugs and phospholipids across the membrane (PubMed:2897240, PubMed:35970996, PubMed:8898203, PubMed:9038218, PubMed:35507548). Catalyzes the flop of phospholipids from the cytoplasmic to the exoplasmic leaflet of the apical membrane. Participates mainly to the flop of phosphatidylcholine, phosphatidylethanolamine, beta-D-glucosylceramides and sphingomyelins (PubMed:8898203). Energy-dependent efflux pump responsible for decreased drug accumulation in multidrug-resistant cells (PubMed:2897240, PubMed:35970996, PubMed:9038218)", "pdb_count": 24, "pdb_ids": [ "6C0V", "6FN1", "6FN4", "6QEX", "7A65", "7A69", "7A6C", "7A6E" ], "grounding": [ { "paper": "Chitosan Nanoparticles for Topical Drug Delivery in Chemotherapy-Induced Alopecia A Comparative Study of Five Repurposed Pharmacological Agents", "quote": "he fact that PHB is an activator of the constitutive androstane receptor (CAR) via the inhibition of epidermal growth factor receptor (EGFR) signaling [111]. CAR is a substrate of ABCB1 (angiotensin-binding cassette B1), one of the ABC family of transporters responsible for multidrug resistance by e", "n_hits": 5 } ], "grounded_in_corpus": true }, { "gene": "ADM", "name": "Adrenomedullin", "diseases": [ "AGA" ], "pathway": "Other", "twin_node": "—", "effect": "?", "role": "modulator", "drugs": [], "mechanism": "Tier-2 multi-omics AGA target; vasoactive peptide implicated in dermal vascular regulation supporting follicles.", "evidence_paper_ids": [ "41285252" ], "n_evidence": 1, "mention_count": 0, "sources": [ "extract" ], "in_model": false, "uncertain": false, "structure": { "accession": "P35318", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/P35318", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-P35318-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-P35318-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/P35318", "mean_plddt": 61.8, "plddt_band": "Low (50–70)", "n_residues": 185, "local_pdb": "digital_twin\\data\\structures\\P35318_AF.pdb" }, "uniprot": "P35318", "uniprot_name": "Pro-adrenomedullin", "length": 185, "function": "Adrenomedullin/ADM and proadrenomedullin N-20 terminal peptide/PAMP are peptide hormones that act as potent hypotensive and vasodilatator agents (PubMed:8387282, PubMed:9620797). Numerous actions have been reported most related to the physiologic control of fluid and electrolyte homeostasis. In the kidney, ADM is diuretic and natriuretic, and both ADM and PAMP inhibit aldosterone secretion by direct adrenal actions. In pituitary gland, both peptides at physiologically relevant doses inhibit basal ACTH secretion. Both peptides appear to act in brain and pituitary gland to facilitate the loss of", "pdb_count": 8, "pdb_ids": [ "2FLY", "2L7S", "4RWF", "5V6Y", "6UUN", "6UUS", "6V2E", "7VV0" ], "grounding": [], "grounded_in_corpus": false }, { "gene": "BAX", "name": "Bcl-2-associated X protein", "diseases": [ "CIA" ], "pathway": "Cell-cycle/apoptosis", "twin_node": "APO", "effect": "+", "role": "driver", "drugs": [], "mechanism": "Increased Bax relative to Bcl-2 after 5-FU exposure promotes mitochondrial apoptosis in hair follicle cells, contributing to CIA.", "evidence_paper_ids": [ "39922517" ], "n_evidence": 1, "mention_count": 0, "sources": [ "discover:CIA", "extract" ], "in_model": false, "uncertain": false, "structure": { "accession": "Q07812", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/Q07812", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-Q07812-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-Q07812-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/Q07812", "mean_plddt": 86.0, "plddt_band": "Confident (70–90)", "n_residues": 192, "local_pdb": "digital_twin\\data\\structures\\Q07812_AF.pdb" }, "uniprot": "Q07812", "uniprot_name": "Apoptosis regulator BAX", "length": 192, "function": "Plays a role in the mitochondrial apoptotic process (PubMed:10772918, PubMed:11060313, PubMed:16113678, PubMed:16199525, PubMed:18948948, PubMed:21199865, PubMed:21458670, PubMed:25609812, PubMed:36361894, PubMed:8358790, PubMed:8521816). Under normal conditions, BAX is largely cytosolic via constant retrotranslocation from mitochondria to the cytosol mediated by BCL2L1/Bcl-xL, which avoids accumulation of toxic BAX levels at the mitochondrial outer membrane (MOM) (PubMed:21458670). Under stress conditions, undergoes a conformation change that causes translocation to the mitochondrion membrane", "pdb_count": 37, "pdb_ids": [ "1F16", "2G5B", "2K7W", "2LR1", "3PK1", "3PL7", "4BD2", "4BD6" ], "grounding": [ { "paper": "Polyphenols from Bacopa procumbens Nanostructured with Gold Nanoparticles Stimulate Hair Growth Through Apoptosis Modulation in C57BL 6 Mice", "quote": "metabolites of B. procumbens present in BFNB were analyzed in silico. In vivo experiments evaluated the expression of pro-apoptotic markers p53, caspase 3-p11, caspase 9-p10, and Bax, as well as anti-apoptotic marker Bcl-2, through Western blotting. Immunohistochemistry further assessed the expressi", "n_hits": 33 }, { "paper": "Caizhixuan hair tonic regulates both apoptosis and the PI3K Akt pathway to treat androgenetic alopecia", "quote": "AGA by regulating PI3K/Akt and apoptosis pathways. According to RT-qPCR and Western blotting, CZX upregulated the expressions of PI3K, Akt, and Bcl-2, while downregulating that of Bax and caspase-3. PLOS ONE PLOS ONE | https://doi.org/10.1371/journal.pone.0282427 February 24, 2023 1 / 15 a1111111111", "n_hits": 13 }, { "paper": "Connarus semidecandrus Jack Exerts Anti-Alopecia Effects by Targeting 5α-Reductase Activity and an Intrinsic Apoptotic Pathway", "quote": "root sheath keratinocytes [17]. The canonical pathway of apoptosis is controlled by the anti-apoptotic Bcl-2 family (Bcl-2, Bcl-XL, and Bcl-W) and the pro-apoptotic Bcl-2 family (Bax, Bak, and Bad) [18]. During catagen, the Bcl-2/Bax ratio decreases dramatically compared with anagen levels. That shi", "n_hits": 11 }, { "paper": "Stauntonia hexaphylla Extract Ameliorates Androgenic Alopecia by Inhibiting Androgen Signaling in Testosterone-induced Alopecia Mice", "quote": "erating cell nuclear antigen (PCNA). Results: In human follicular dermal papilla cells, the 5α-reductase and AR were decreased following S. hexaphylla treatment, which reduced the Bax/Bcl-2 ratio. Histologically, the dermal thickness and follicle number were higher in the S. hexaphylla groups com- p", "n_hits": 11 } ], "grounded_in_corpus": true }, { "gene": "BRAF", "name": "Serine/threonine-protein kinase B-raf", "diseases": [ "AGA" ], "pathway": "Growth factor", "twin_node": "DP", "effect": "?", "role": "modulator", "drugs": [], "mechanism": "Tier-3 multi-omics AGA candidate; MAPK-pathway kinase prioritized as a potential therapeutic target for hair loss.", "evidence_paper_ids": [ "41285252" ], "n_evidence": 1, "mention_count": 0, "sources": [ "extract" ], "in_model": false, "uncertain": false, "structure": { "accession": "P15056", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/P15056", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-P15056-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-P15056-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/P15056", "mean_plddt": 66.4, "plddt_band": "Low (50–70)", "n_residues": 766, "local_pdb": "digital_twin\\data\\structures\\P15056_AF.pdb" }, "uniprot": "P15056", "uniprot_name": "Serine/threonine-protein kinase B-raf", "length": 766, "function": "Protein kinase involved in the transduction of mitogenic signals from the cell membrane to the nucleus (Probable). Phosphorylates MAP2K1, and thereby activates the MAP kinase signal transduction pathway (PubMed:21441910, PubMed:29433126). Phosphorylates PFKFB2 (PubMed:36402789). May play a role in the postsynaptic responses of hippocampal neurons (PubMed:1508179)", "pdb_count": 127, "pdb_ids": [ "1UWH", "1UWJ", "2FB8", "2L05", "3C4C", "3D4Q", "3IDP", "3II5" ], "grounding": [ { "paper": "Skin cancer understanding the journey of transformation from conventional to advanced treatment approaches.", "quote": "ctivated, an interaction between an RTK and its corresponding ligand is crucial. This interaction trig- gers the activation of rapidly accelerated fibrosarcoma (RAF) components (BRAF, ARAF, and CRAF), which are integral to the pathway [110]. This series of events set off Page 10 of 70 Hasan et al. M", "n_hits": 26 }, { "paper": "ISEV2025 Abstract Book.", "quote": "this study, we applied nano-flow cytometry, quantitative proteomics, high- throughput uptake screening, and in vivo tracking to analyse EVs released by cancer cells with KRAS and BRAF mutations. Methods: EVs were isolated by size exclusion chromatography from wild-type (Caco2, H292, H1703), BRAF-mut", "n_hits": 11 } ], "grounded_in_corpus": true }, { "gene": "CASP3", "name": "Caspase-3", "diseases": [ "CIA" ], "pathway": "Cell-cycle/apoptosis", "twin_node": "APO", "effect": "+", "role": "driver", "drugs": [ "Emricasan (pan-caspase inhibitor, experimental)" ], "mechanism": "Executioner apoptosis protease elevated in chemotherapy-damaged follicles; its reduction limits follicular cell death and alopecia.", "evidence_paper_ids": [ "39922517", "40672523", "41371370" ], "n_evidence": 3, "mention_count": 0, "sources": [ "discover:CIA", "extract" ], "in_model": false, "uncertain": false, "structure": { "accession": "P42574", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/P42574", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-P42574-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-P42574-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/P42574", "mean_plddt": 85.8, "plddt_band": "Confident (70–90)", "n_residues": 277, "local_pdb": "digital_twin\\data\\structures\\P42574_AF.pdb" }, "uniprot": "P42574", "uniprot_name": "Caspase-3", "length": 277, "function": "Thiol protease that acts as a major effector caspase involved in the execution phase of apoptosis (PubMed:18723680, PubMed:20566630, PubMed:23650375, PubMed:35338844, PubMed:35446120, PubMed:7596430). Following cleavage and activation by initiator caspases (CASP8, CASP9 and/or CASP10), mediates execution of apoptosis by catalyzing cleavage of many proteins (PubMed:18723680, PubMed:20566630, PubMed:23650375, PubMed:7596430). At the onset of apoptosis, it proteolytically cleaves poly(ADP-ribose) polymerase PARP1 at a '216-Asp-|-Gly-217' bond (PubMed:10497198, PubMed:16374543, PubMed:7596430, Pub", "pdb_count": 135, "pdb_ids": [ "1CP3", "1GFW", "1I3O", "1NME", "1NMQ", "1NMS", "1PAU", "1QX3" ], "grounding": [ { "paper": "Polyphenols from Bacopa procumbens Nanostructured with Gold Nanoparticles Stimulate Hair Growth Through Apoptosis Modulation in C57BL 6 Mice", "quote": "ptosis revitalizes the hair cycle, improves hair quality, and extends its growth phase. This includes interventions aimed at reducing pro-apoptotic markers such as p53, caspase 3 (Casp3), and caspase 9 (Casp9) while promoting the expression of anti-apoptotic markers such as Bcl-2. Plant extracts suc", "n_hits": 58 }, { "paper": "Promotion of Hair Regrowth in Androgenetic Alopecia with Supplemented Erzhi Wan Exploring Its Mechanism Using Network Pharmacology and Molecular Docking", "quote": "cacetin ADRB2 Mohanlian MOL001689 Acacetin RELA Mohanlian MOL001689 Acacetin BCL2 Mohanlian MOL001689 Acacetin CDKN1A Mohanlian MOL001689 Acacetin BAX Mohanlian MOL001689 Acacetin CASP3 Mohanlian MOL001689 Acacetin TP53 Mohanlian MOL001689 Acacetin CASP8 Mohanlian MOL001689 Acacetin FASN Mohanlian M", "n_hits": 8 }, { "paper": "Molecular signatures and signaling interactions of the hair follicle stem cell niche.", "quote": "l. To evaluate the hair cycle wave, we analyzed the hair cycle phases in four consecutive zones across the back skins of K14-H2BGFP mice. Immunofluorescence for active caspase-3 (CASP3*) detected cell death during late catagen and KI67 marked cell proliferation in early anagen (Figure 1i, Supplement", "n_hits": 4 }, { "paper": "Effects of Baicalin on Alopecia and the Associated Mechanism", "quote": "P CMA1 KDR LCK MDM2 IL2 SYK PGR ESR2 SRC HSP90AA1 PTPN11 AKT1 ESR1 TTR FGFR2 DHODH STS DHFR OTC LTA4H PLK1 CFB NMNAT1 CYP19A1 THRB IGF1R PTPN1 JAK3 AR EGFR JAK2 PRKACA NOS3 MAPK14 CASP3 ALB CTNNA1 IGF1 MMP9 (c) KDR ELANE MDM2 IL2 JAK2 PRKACA NOS3 MAPK14 CASP3 PTPN11 AR ESR1 HSP90AA1 ALB RHOA MMP9 IG", "n_hits": 2 } ], "grounded_in_corpus": true }, { "gene": "CCL26", "name": "C-C motif chemokine ligand 26", "diseases": [ "AA" ], "pathway": "Chemokine", "twin_node": "INF", "effect": "+", "role": "driver", "drugs": [], "mechanism": "CCL26 (eotaxin-3) is enriched in lesional AA stromal cells, supporting Th2-associated chemotaxis within the inflammatory infiltrate.", "evidence_paper_ids": [ "41740930" ], "n_evidence": 1, "mention_count": 0, "sources": [ "extract" ], "in_model": false, "uncertain": false, "structure": { "accession": "Q9Y258", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/Q9Y258", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-Q9Y258-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-Q9Y258-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/Q9Y258", "mean_plddt": 84.3, "plddt_band": "Confident (70–90)", "n_residues": 94, "local_pdb": "digital_twin\\data\\structures\\Q9Y258_AF.pdb" }, "uniprot": "Q9Y258", "uniprot_name": "C-C motif chemokine 26", "length": 94, "function": "Chemoattractant for eosinophils and basophils (PubMed:10415065, PubMed:10488147). Acts as a ligand for C-C chemokine receptor CCR3 which triggers Ca(2+) mobilization in eosinophils (PubMed:10415065, PubMed:10488147, PubMed:11425309). Also acts as a ligand for CX3C chemokine receptor CX3CR1, inducing cell chemotaxis (PubMed:20974991)", "pdb_count": 2, "pdb_ids": [ "1G2S", "1G2T" ], "grounding": [], "grounded_in_corpus": false }, { "gene": "CCND1", "name": "Cyclin D1", "diseases": [ "AGA" ], "pathway": "Cell-cycle/apoptosis", "twin_node": "DP", "effect": "+", "role": "protector", "drugs": [], "mechanism": "Wnt/β-catenin target gene promoting dermal papilla cell proliferation; its DHT-induced downregulation is reversed by pro-growth flavonoids.", "evidence_paper_ids": [ "41338418" ], "n_evidence": 1, "mention_count": 0, "sources": [ "extract" ], "in_model": false, "uncertain": false, "structure": { "accession": "P24385", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/P24385", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-P24385-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-P24385-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/P24385", "mean_plddt": 87.3, "plddt_band": "Confident (70–90)", "n_residues": 295, "local_pdb": "digital_twin\\data\\structures\\P24385_AF.pdb" }, "uniprot": "P24385", "uniprot_name": "G1/S-specific cyclin-D1", "length": 295, "function": "Regulatory component of the cyclin D1-CDK4 (DC) complex that phosphorylates and inhibits members of the retinoblastoma (RB) protein family including RB1 and regulates the cell-cycle during G(1)/S transition (PubMed:1827756, PubMed:1833066, PubMed:19412162, PubMed:33854235, PubMed:8114739, PubMed:8302605). Phosphorylation of RB1 allows dissociation of the transcription factor E2F from the RB/E2F complex and the subsequent transcription of E2F target genes which are responsible for the progression through the G(1) phase (PubMed:1827756, PubMed:1833066, PubMed:19412162, PubMed:8114739, PubMed:830", "pdb_count": 11, "pdb_ids": [ "2W96", "2W99", "2W9F", "2W9Z", "5VZU", "6P8E", "6P8F", "6P8G" ], "grounding": [ { "paper": "Promotion of Hair Regrowth in Androgenetic Alopecia with Supplemented Erzhi Wan Exploring Its Mechanism Using Network Pharmacology and Molecular Docking", "quote": "Luteolin DPP4 Mohanlian MOL000006 Luteolin RELA Mohanlian MOL000006 Luteolin EGFR Mohanlian MOL000006 Luteolin AKT1 Mohanlian MOL000006 Luteolin VEGFA Mohanlian MOL000006 Luteolin CCND1 Mohanlian MOL000006 Luteolin BCL2L1 Mohanlian MOL000006 Luteolin CDKN1A Mohanlian MOL000006 Luteolin CASP9 Mohanli", "n_hits": 4 }, { "paper": "Restoration of follicular β-catenin signaling by mesenchymal stem cells promotes hair growth in mice with androgenetic alopecia", "quote": "​AGC​TGCC​ GCA​CAG​TCC​TGA​TCA​TCG​GT Caspase8 (mouse) TCT​TAA​GGC​GGG​CAG​AAA​GC GGG​ACA​GAA​ATG​CCT​CCG​AA Caspase9 (mouse) TCC​CAG​GTT​TTG​TCT​CCT​GG CAA​GCC​ATG​AGA​GCT​TCG​GA Ccnd1 (mouse) AGA​GGC​GGA​TGA​GAA​CAA​GC CCT​TGT​TTA​GCC​AGA​GGC​CG Ccna1 (mouse) ACC​GTG​CTA​GGG​GTG​TTG​A CGT​TTG​GCT​", "n_hits": 3 }, { "paper": "Therapeutic potential of isoproterenol in androgenetic alopecia activation of hair follicle stem cells via the PI3K AKT β-Catenin signaling pathway", "quote": "ons [14]. qPCR analysis demonstrated that ISO treatment increased β-catenin expression in cell population enriched in HFSC, along with the upregula­ tion of c-myc and Cyclin D1 (CCND1), genes associated with cell division and growth regulation (Fig. 5A-C). Fur­ ther analysis with LY-294 showed that ", "n_hits": 3 } ], "grounded_in_corpus": true }, { "gene": "COL5A3", "name": "Collagen type V alpha 3 chain", "diseases": [ "AA" ], "pathway": "Other", "twin_node": "—", "effect": "?", "role": "modulator", "drugs": [], "mechanism": "COL5A3 is enriched in lesional AA fibroblasts, marking extracellular matrix remodeling in the inflamed scalp stroma.", "evidence_paper_ids": [ "41740930" ], "n_evidence": 1, "mention_count": 0, "sources": [ "extract" ], "in_model": false, "uncertain": false, "structure": { "accession": "P25940", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/P25940", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-P25940-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-P25940-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/P25940", "mean_plddt": 50.1, "plddt_band": "Low (50–70)", "n_residues": 1745, "local_pdb": "digital_twin\\data\\structures\\P25940_AF.pdb" }, "uniprot": "P25940", "uniprot_name": "Collagen alpha-3(V) chain", "length": 1745, "function": "Type V collagen is a member of group I collagen (fibrillar forming collagen). It is a minor connective tissue component of nearly ubiquitous distribution. Type V collagen binds to DNA, heparan sulfate, thrombospondin, heparin, and insulin", "pdb_count": 0, "pdb_ids": [], "grounding": [], "grounded_in_corpus": false }, { "gene": "COL6A6", "name": "Collagen type VI alpha 6 chain", "diseases": [ "AA" ], "pathway": "Other", "twin_node": "—", "effect": "?", "role": "modulator", "drugs": [], "mechanism": "COL6A6 is enriched in lesional AA fibroblasts, contributing to pro-fibrotic extracellular matrix changes in affected scalp.", "evidence_paper_ids": [ "41740930" ], "n_evidence": 1, "mention_count": 0, "sources": [ "extract" ], "in_model": false, "uncertain": false, "structure": { "accession": "A6NMZ7", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/A6NMZ7", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-A6NMZ7-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-A6NMZ7-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/A6NMZ7", "mean_plddt": 74.8, "plddt_band": "Confident (70–90)", "n_residues": 2263, "local_pdb": "digital_twin\\data\\structures\\A6NMZ7_AF.pdb" }, "uniprot": "A6NMZ7", "uniprot_name": "Collagen alpha-6(VI) chain", "length": 2263, "function": "Collagen VI acts as a cell-binding protein", "pdb_count": 0, "pdb_ids": [], "grounding": [], "grounded_in_corpus": false }, { "gene": "CRP", "name": "C-reactive protein", "diseases": [ "AA" ], "pathway": "Other", "twin_node": "—", "effect": "?", "role": "modulator", "drugs": [], "mechanism": "Serum C-reactive protein serves as a systemic inflammation biomarker in severe AA and tends to decrease alongside other indices after JAK inhibitor therapy.", "evidence_paper_ids": [ "41517644" ], "n_evidence": 1, "mention_count": 0, "sources": [ "extract" ], "in_model": false, "uncertain": false, "structure": { "accession": "P02741", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/P02741", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-P02741-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-P02741-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/P02741", "mean_plddt": 94.1, "plddt_band": "Very high (≥90)", "n_residues": 224, "local_pdb": "digital_twin\\data\\structures\\P02741_AF.pdb" }, "uniprot": "P02741", "uniprot_name": "C-reactive protein", "length": 224, "function": "Displays several functions associated with host defense: it promotes agglutination, bacterial capsular swelling, phagocytosis and complement fixation through its calcium-dependent binding to phosphorylcholine. Can interact with DNA and histones and may scavenge nuclear material released from damaged circulating cells", "pdb_count": 16, "pdb_ids": [ "1B09", "1GNH", "1LJ7", "3L2Y", "3PVN", "3PVO", "7PK9", "7PKB" ], "grounding": [ { "paper": "ISEV2025 Abstract Book.", "quote": "at different time-points. Methods: Human melanoma cell lines (MV3 and A2058) were studied in 3D spheroid cultures. Human platelets were acti- vated with collagen related peptide (CRP), fucoidan from Fucus vesiculosus (FFV), thrombin and collagen co-stimulus (TC) and Ca2+ ionophore (Ca2+). PEVs were ", "n_hits": 15 }, { "paper": "Clinical Practice Guidelines for Menopause An Executive Summary and Recommendations Indian Menopause Society 2026.", "quote": "osis (Grade B).[62,66,67] 34. Hospital and community-based studies further implicate low body mass index (BMI), poor sleep, elevated triglycerides, increased C-reactive protein (CRP), and EM as significant risk factors (Grade B).[65,68-71] 35. Nutritional deficits are widespread: about 3 in 4 women ", "n_hits": 6 }, { "paper": "Abnormal uterine bleeding control with combined oral contraceptives a review comparing ethinylestradiol and natural hormones.", "quote": "women Use of COCs containing either EV + DNG or EE + DNG Use of DNG only EV + DNG and DNG only had a neutral effect on inflammation and lipids, while EE + DNG increased both hs-CRP and PTX-3 levels as well as triglycerides and HDL Wang et al. (2016)(11) Int J Epidemiol 5841 women Women using combine", "n_hits": 2 }, { "paper": "Exosome-Based Therapies for Alopecia Areata A Systematic Review of Clinical and Experimental Evidence.", "quote": "clinically significant changes were observed in complete blood counts, hepatic transaminases (AST, ALT), renal function parameters (creatinine, BUN), or inflammatory markers (ESR, CRP) [12]. Specifically, mean AST and ALT levels remained within normal limits at baseline (AST: 24 ± 6 U/L; ALT: 22 ± 8", "n_hits": 2 } ], "grounded_in_corpus": true }, { "gene": "CXCL9", "name": "C-X-C motif chemokine ligand 9", "diseases": [ "AA" ], "pathway": "Chemokine", "twin_node": "INF", "effect": "+", "role": "driver", "drugs": [], "mechanism": "CXCL9, an IFN-γ-inducible chemokine, is enriched in lesional AA fibroblasts and smooth muscle cells, recruiting CXCR3+ cytotoxic T cells to the follicle.", "evidence_paper_ids": [ "41740930" ], "n_evidence": 1, "mention_count": 0, "sources": [ "discover:AA", "extract" ], "in_model": false, "uncertain": false, "structure": { "accession": "Q07325", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/Q07325", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-Q07325-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-Q07325-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/Q07325", "mean_plddt": 87.5, "plddt_band": "Confident (70–90)", "n_residues": 125, "local_pdb": "digital_twin\\data\\structures\\Q07325_AF.pdb" }, "uniprot": "Q07325", "uniprot_name": "C-X-C motif chemokine 9", "length": 125, "function": "Cytokine that affects the growth, movement, or activation state of cells that participate in immune and inflammatory response. Chemotactic for activated T-cells. Binds to CXCR3", "pdb_count": 0, "pdb_ids": [], "grounding": [ { "paper": "CXCR3 Blockade Inhibits T-cell Migration into the Skin and Prevents Development of Alopecia Areata", "quote": "transcriptional profiling of human and mouse alopecic skin showed that the IFN pathway is the dominant signaling pathway involved in AA. We showed that IFN inducible chemokines (CXCL9/10/11) are markedly upregulated in the skin of AA lesions, and further, that the IFN inducible chemokine receptor, C", "n_hits": 59 }, { "paper": "Modulating immune responses in alopecia therapeutic insights and potential targets of antisense oligonucleotides", "quote": "aracterized by sudden hair loss, with interferon-gamma (IFN-γ) playing a pivotal role in pathogenesis. The upregulation of IFN response genes, including IFN-inducible chemokines CXCL9, CXCL10, and CXCL11, in lesional skin reflects the activation of the IFN response pathway and contributes to immune ", "n_hits": 13 }, { "paper": "Induction of alopecia areata in C3H HeJ mice using polyinosinic-polycytidylic acid (poly[IC]) and interferon-gamma", "quote": "ing of the AA lesions revealed increased infiltration of CD4+ and CD8+ cells infiltration around the hair follicles. IFNγ and poly(I:C) increased the expression of NLRP3, IL-1β, CXCL9, CXCL10, and CXCL11 in mouse skin. Taken together, these findings indicate a shorter and more convenient means of AA", "n_hits": 10 }, { "paper": "Selective Janus kinase 1 inhibition resolves inflammation and restores hair growth offering a viable treatment option for alopecia areata", "quote": "/www.ncbi.nlm.nih.gov/geo/query/ acc.cgi?acc=GSE94235) and GSE94236 (mouse skin samples) (https://www.ncbi.nlm.nih.gov/geo/query/acc. cgi?acc=GSE94236). 2.4.6 | ALADIN scores IFN (Cxcl9, Cxcl10, Cxcl11, Stat1, and Mx1) and CTL (Cd8a, Gzmb, Icos, Prf1) ALADIN scores for the Taq- man data were calcula", "n_hits": 3 } ], "grounded_in_corpus": true }, { "gene": "CYBB", "name": "NADPH oxidase 2 (NOX2/gp91phox)", "diseases": [ "CIA" ], "pathway": "Oxidative stress", "twin_node": "APO", "effect": "+", "role": "driver", "drugs": [], "mechanism": "NOX2 generates reactive oxygen species downstream of S100A8/NCF2 to drive ferroptosis-mediated hair follicle damage in chemotherapy-induced alopecia.", "evidence_paper_ids": [ "39947495" ], "n_evidence": 1, "mention_count": 0, "sources": [ "extract" ], "in_model": false, "uncertain": false, "structure": { "accession": "P04839", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/P04839", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-P04839-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-P04839-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/P04839", "mean_plddt": 90.2, "plddt_band": "Very high (≥90)", "n_residues": 570, "local_pdb": "digital_twin\\data\\structures\\P04839_AF.pdb" }, "uniprot": "P04839", "uniprot_name": "NADPH oxidase 2", "length": 570, "function": "Catalytic subunit of the phagocyte NADPH oxidase complex that mediates the transfer of electrons from cytosolic NADPH to O2 to produce the superoxide anion (O2(-)) (PubMed:15338276, PubMed:36241643, PubMed:36413210, PubMed:38355798). In the activated complex, electrons are first transferred from NADPH to flavin adenine dinucleotide (FAD) and subsequently transferred via two heme molecules to molecular oxygen, producing superoxide through an outer-sphere reaction (Probable) (PubMed:38355798). Activation of the NADPH oxidase complex is initiated by the assembly of cytosolic subunits of the NADPH", "pdb_count": 6, "pdb_ids": [ "3A1F", "7U8G", "8GZ3", "8KEI", "8WEJ", "8X2L" ], "grounding": [], "grounded_in_corpus": false }, { "gene": "DCT", "name": "Dopachrome tautomerase (tyrosinase-related protein 2)", "diseases": [ "CIA" ], "pathway": "Other", "twin_node": "—", "effect": "?", "role": "protector", "drugs": [], "mechanism": "Melanogenic enzyme whose expression is increased to restore melanocyte/melanogenesis function during follicular regeneration.", "evidence_paper_ids": [ "41192849" ], "n_evidence": 1, "mention_count": 0, "sources": [ "extract" ], "in_model": false, "uncertain": false, "structure": { "accession": "P40126", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/P40126", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-P40126-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-P40126-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/P40126", "mean_plddt": 89.1, "plddt_band": "Confident (70–90)", "n_residues": 519, "local_pdb": "digital_twin\\data\\structures\\P40126_AF.pdb" }, "uniprot": "P40126", "uniprot_name": "L-dopachrome tautomerase", "length": 519, "function": "Plays a role in melanin biosynthesis (PubMed:33100333). Catalyzes the conversion of L-dopachrome into 5,6-dihydroxyindole-2-carboxylic acid (DHICA)", "pdb_count": 1, "pdb_ids": [ "4HX1" ], "grounding": [ { "paper": "Mice with Alopecia, Osteoporosis, and Systemic Amyloidosis Due to Mutation in Zdhhc13, a Gene Coding for Palmitoyl Acyltransferase", "quote": ".13 6.360.09 2.7760.11 5.4560.04 DDCt3 0 1.93 0 2.68 2(DDCt) 4 100% 26.23% 100% 15.59% 1 Ct, cycle threshold. Values represent triplicates of 3 wild type and 3 affected animals. 2 DCt = Ct (Zdhhc13)- Ct (B-actin). 3 DDCt = DCt (Affected) - DCt (Control). 4 2(DDCt) represents relative expression leve", "n_hits": 4 } ], "grounded_in_corpus": true }, { "gene": "ENTPD1", "name": "Ectonucleoside triphosphate diphosphohydrolase 1 (CD39)", "diseases": [ "AA" ], "pathway": "Other", "twin_node": "—", "effect": "?", "role": "protector", "drugs": [], "mechanism": "CD39 on γδTregs drives adenosine generation that suppresses pathogenic CD8+ T-cell activity in AA.", "evidence_paper_ids": [ "41579939" ], "n_evidence": 1, "mention_count": 0, "sources": [ "extract" ], "in_model": false, "uncertain": false, "structure": { "accession": "P49961", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/P49961", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-P49961-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-P49961-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/P49961", "mean_plddt": 91.0, "plddt_band": "Very high (≥90)", "n_residues": 510, "local_pdb": "digital_twin\\data\\structures\\P49961_AF.pdb" }, "uniprot": "P49961", "uniprot_name": "Ectonucleoside triphosphate diphosphohydrolase 1", "length": 510, "function": "Catalyzes the hydrolysis of nucleoside triphosphates (NTPs) and diphosphates (NDPs) (Probable) (PubMed:8529670, PubMed:8626624, PubMed:8955160, PubMed:8996251). The enzyme sequentially removes phosphate groups in two successive steps, converting NTPs to nucleoside monophosphates (NMPs) via NDP intermediates (Probable) (PubMed:8529670, PubMed:8626624, PubMed:8955160, PubMed:8996251). This activity contributes to the regulation of extracellular levels of nucleotides (Probable) (PubMed:8529670, PubMed:8626624, PubMed:8955160, PubMed:8996251). By hydrolyzing proinflammatory ATP and platelet-activa", "pdb_count": 0, "pdb_ids": [], "grounding": [], "grounded_in_corpus": false }, { "gene": "ESR1", "name": "Estrogen receptor 1", "diseases": [ "AGA" ], "pathway": "Nuclear receptor", "twin_node": "HFSC", "effect": "+", "role": "protector", "drugs": [], "mechanism": "Estrogen signaling via estrogen receptors is proposed to provide protective effects against follicular miniaturization in female AGA.", "evidence_paper_ids": [ "41714473", "PPR1134993" ], "n_evidence": 2, "mention_count": 0, "sources": [ "extract" ], "in_model": false, "uncertain": true, "structure": { "accession": "P03372", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/P03372", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-P03372-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-P03372-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/P03372", "mean_plddt": 66.4, "plddt_band": "Low (50–70)", "n_residues": 595, "local_pdb": "digital_twin\\data\\structures\\P03372_AF.pdb" }, "uniprot": "P03372", "uniprot_name": "Estrogen receptor", "length": 595, "function": "Nuclear hormone receptor. The steroid hormones and their receptors are involved in the regulation of eukaryotic gene expression and affect cellular proliferation and differentiation in target tissues. Ligand-dependent nuclear transactivation involves either direct homodimer binding to a palindromic estrogen response element (ERE) sequence or association with other DNA-binding transcription factors, such as AP-1/c-Jun, c-Fos, ATF-2, Sp1 and Sp3, to mediate ERE-independent signaling. Ligand binding induces a conformational change allowing subsequent or combinatorial association with multiprotein", "pdb_count": 457, "pdb_ids": [ "1A52", "1ERE", "1ERR", "1G50", "1GWQ", "1GWR", "1HCP", "1HCQ" ], "grounding": [ { "paper": "Promotion of Hair Regrowth in Androgenetic Alopecia with Supplemented Erzhi Wan Exploring Its Mechanism Using Network Pharmacology and Molecular Docking", "quote": "tetrahydroxybenzofurano[3,2-c] chromen-6-one HSP90AB1 Mohanlian MOL003389 3’-O-Methylorobol NOS2 Mohanlian MOL003389 3’-O-Methylorobol PTGS1 Mohanlian MOL003389 3’-O-Methylorobol ESR1 Mohanlian MOL003389 3’-O-Methylorobol AR Mohanlian MOL003389 3’-O-Methylorobol PPARG Mohanlian MOL003389 3’-O-Methyl", "n_hits": 4 }, { "paper": "Caizhixuan hair tonic regulates both apoptosis and the PI3K Akt pathway to treat androgenetic alopecia", "quote": "3C). Cytoscape 3.8.0 software and the CytoNCA plug-in were used to analyse the topology of the intersection genes. The core genes screened were JUN, CYP1A1, CYP19A1, Akt1, CYP3A4, ESR1, AR, and GAPDH (Fig 3D). We speculated that these targets may be the key targets of CZX in AGA treatment. Predictio", "n_hits": 2 }, { "paper": "Effects of Baicalin on Alopecia and the Associated Mechanism", "quote": "BG PIK3CG C1S C1R RAC2 HADH SHMT1 F10 SNRPA PPARA GC TPH1 RXRA CASP7 CFD AHCY DCK XIAP CHIT1 NR1H2 MMP13 MMP1 APCS TYMP CMA1 KDR LCK MDM2 IL2 SYK PGR ESR2 SRC HSP90AA1 PTPN11 AKT1 ESR1 TTR FGFR2 DHODH STS DHFR OTC LTA4H PLK1 CFB NMNAT1 CYP19A1 THRB IGF1R PTPN1 JAK3 AR EGFR JAK2 PRKACA NOS3 MAPK14 CA", "n_hits": 2 }, { "paper": "Exploring the Efficacy and Potential Mechanisms of Topical Periplaneta americana (L.) Extract in Treating Androgenetic Alopecia in a Mouse Model A Systems Pharmacology and Skin Microbiome Analysis", "quote": "ing conditions of the Centiscape 2.2 software plug-in, the interaction network between 24 core protein nodes and 157 edges was screened (Figure 2C). Among them, MAPK1, Bcl-2, Akt, ESR1, and other core proteins that play a positive role in AGA therapy had strong correlations. Figure 2. Screening of c", "n_hits": 2 } ], "grounded_in_corpus": true }, { "gene": "FAS", "name": "Fas cell surface death receptor", "diseases": [ "CIA" ], "pathway": "Cell-cycle/apoptosis", "twin_node": "APO", "effect": "+", "role": "driver", "drugs": [], "mechanism": "Fas death-receptor signaling promotes apoptosis of hair matrix cells in chemotherapy-induced alopecia and is downregulated by protective treatment.", "evidence_paper_ids": [ "39638216" ], "n_evidence": 1, "mention_count": 0, "sources": [ "extract" ], "in_model": false, "uncertain": false, "structure": { "accession": "P25445", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/P25445", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-P25445-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-P25445-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/P25445", "mean_plddt": 77.9, "plddt_band": "Confident (70–90)", "n_residues": 335, "local_pdb": "digital_twin\\data\\structures\\P25445_AF.pdb" }, "uniprot": "P25445", "uniprot_name": "Tumor necrosis factor receptor superfamily member 6", "length": 335, "function": "Receptor for TNFSF6/FASLG. The adapter molecule FADD recruits caspase CASP8 to the activated receptor. The resulting death-inducing signaling complex (DISC) performs CASP8 proteolytic activation which initiates the subsequent cascade of caspases (aspartate-specific cysteine proteases) mediating apoptosis. FAS-mediated apoptosis may have a role in the induction of peripheral tolerance, in the antigen-stimulated suicide of mature T-cells, or both. The secreted isoforms 2 to 6 block apoptosis (in vitro)", "pdb_count": 6, "pdb_ids": [ "1DDF", "2NA7", "3EWT", "3EZQ", "3THM", "3TJE" ], "grounding": [ { "paper": "SOCS3 treatment prevents the development of alopecia areata by inhibiting CD8+ T cell-mediated autoimmune destruction", "quote": "pment of alopecia areata in the graft model. SOCS3 decreases the CD44high CD62Llow effector memory CD8+ T cells, resulting in the decrease of IFN-γ production. The expression of Fas and major histocompatibility complex-1 (MHC I) is upregulated in skin from C3H/ HeJ alopecia areata mice, and this inc", "n_hits": 52 }, { "paper": "Improvement in Patient-Reported Emotional Symptoms and Activity Limitations due to Hair Loss in Patients With Alopecia Areata Treated With Ritlecitini", "quote": "dicate greater impact on ES and AL due to hair loss. 2.3 | Endpoints Changes from baseline (CFBs) in AAPPO ES and AL domain scores for participants in the full analysis set (FAS) (i.e., all Summary • Using the Alopecia Areata Patient Priority Outcomes measure, this study evaluated patient-­reported ", "n_hits": 5 }, { "paper": "Effect of N-acetylcysteine on hair follicle changes in mouse model of cyclophosphamide-induced alopecia histological and biochemical study", "quote": "melano- genesis, apoptosis, proliferation, and migration of follicular melanocytes of C57BL/6 mice. CYP induces apoptosis of some melanocytes in the hair bulb region through the Fas signaling pathway. The remaining surviving hair bulb mel- anocytes express c-kit receptor which causes proliferation a", "n_hits": 4 }, { "paper": "Polyphenols from Bacopa procumbens Nanostructured with Gold Nanoparticles Stimulate Hair Growth Through Apoptosis Modulation in C57BL 6 Mice", "quote": "of topical application, formononetin restored hair follicles to their normal size and stimulated the growth of new hair shafts. This effect was attributed to the inhibition of the Fas/FasL pathway, which led to decreased activation of pro-apoptotic caspases (Casp8 and Casp3), Bax, and p53, along wit", "n_hits": 4 } ], "grounded_in_corpus": true }, { "gene": "FGF10", "name": "Fibroblast growth factor 10", "diseases": [ "CIA" ], "pathway": "Growth factor", "twin_node": "DP", "effect": "+", "role": "protector", "drugs": [], "mechanism": "FGF10 supports hair follicle growth signaling from the dermal papilla; its decreased secretion after 5-FU impairs anagen maintenance.", "evidence_paper_ids": [ "39922517" ], "n_evidence": 1, "mention_count": 0, "sources": [ "extract" ], "in_model": false, "uncertain": false, "structure": { "accession": "O15520", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/O15520", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-O15520-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-O15520-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/O15520", "mean_plddt": 80.0, "plddt_band": "Confident (70–90)", "n_residues": 208, "local_pdb": "digital_twin\\data\\structures\\O15520_AF.pdb" }, "uniprot": "O15520", "uniprot_name": "Fibroblast growth factor 10", "length": 208, "function": "Plays an important role in the regulation of embryonic development, cell proliferation and cell differentiation. Required for normal branching morphogenesis. May play a role in wound healing", "pdb_count": 2, "pdb_ids": [ "1NUN", "8YQ1" ], "grounding": [ { "paper": "Molecular signatures and signaling interactions of the hair follicle stem cell niche.", "quote": "at the zone-enriched expression is linked to body position and unrelated to hair cycle phases (Supplementary Figure S3h and i). Other signature genes among the 211 DEGs included Fgf10, Corin, and Sox11, previously reported in DP or its dermal condensate precursor cells during development (Enshell-Se", "n_hits": 4 }, { "paper": "CXCL12 Drives Reversible Fibroimmune Remodeling in Androgenetic Alopecia Revealed by Single-Cell RNA Sequencing", "quote": "with limited changes in ACKR3 (Figure S10A). To dissect DPC heterogeneity, we performed unsupervised subclustering of DPCs (Figure 5E), revealing five distinct subpopulations: (1) Fgf10+ Rspo3+ active anagen DPCs, (2) Bmp4+ Bmp6+ quiescent telogen DPCs, (3) Sox2+Twist1+ DPCs, (4) Mki67+ proliferatin", "n_hits": 3 } ], "grounded_in_corpus": true }, { "gene": "GZMH", "name": "Granzyme H", "diseases": [ "AA" ], "pathway": "Cell-cycle/apoptosis", "twin_node": "APO", "effect": "+", "role": "driver", "drugs": [], "mechanism": "Granzyme H is upregulated in lesional AA reflecting cytotoxic T-cell-mediated killing of hair follicle epithelial cells.", "evidence_paper_ids": [ "41740930" ], "n_evidence": 1, "mention_count": 0, "sources": [ "extract" ], "in_model": false, "uncertain": false, "structure": { "accession": "P20718", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/P20718", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-P20718-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-P20718-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/P20718", "mean_plddt": 92.4, "plddt_band": "Very high (≥90)", "n_residues": 246, "local_pdb": "digital_twin\\data\\structures\\P20718_AF.pdb" }, "uniprot": "P20718", "uniprot_name": "Granzyme H", "length": 246, "function": "Cytotoxic chymotrypsin-like serine protease with preference for bulky and aromatic residues at the P1 position and acidic residues at the P3' and P4' sites. Probably necessary for target cell lysis in cell-mediated immune responses. Participates in the antiviral response via direct cleavage of several proteins essential for viral replication", "pdb_count": 4, "pdb_ids": [ "3TJU", "3TJV", "3TK9", "4GAW" ], "grounding": [], "grounded_in_corpus": false }, { "gene": "GZMK", "name": "Granzyme K", "diseases": [ "AA" ], "pathway": "Cell-cycle/apoptosis", "twin_node": "APO", "effect": "+", "role": "driver", "drugs": [], "mechanism": "Granzyme K is upregulated in lesional AA, marking cytotoxic effector activity that destroys follicular cells.", "evidence_paper_ids": [ "41740930" ], "n_evidence": 1, "mention_count": 0, "sources": [ "extract" ], "in_model": false, "uncertain": false, "structure": { "accession": "P49863", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/P49863", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-P49863-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-P49863-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/P49863", "mean_plddt": 85.4, "plddt_band": "Confident (70–90)", "n_residues": 264, "local_pdb": "digital_twin\\data\\structures\\P49863_AF.pdb" }, "uniprot": "P49863", "uniprot_name": "Granzyme K", "length": 264, "function": "Serine protease that initiates the GZMK pathway of the complement system, a cascade of proteins directly activated by CD8(+) T-cells that leads to phagocytosis and breakdown of pathogens and signaling that strengthens the adaptive immune system (PubMed:3262682, PubMed:39814882, PubMed:39914456). GZMK is specifically secreted by CD8(+) T-cells and mediates both recognition and initiation steps of GZMK complement pathway (PubMed:39914456). First acts as a pattern recognition receptor, which specifically recognizes and binds heparan sulfate glycosaminoglycans on the pathogen surface to drive opso", "pdb_count": 2, "pdb_ids": [ "1MZA", "1MZD" ], "grounding": [], "grounded_in_corpus": false }, { "gene": "HDAC1", "name": "Histone deacetylase 1", "diseases": [ "AGA" ], "pathway": "Cell-cycle/apoptosis", "twin_node": "APO", "effect": "-", "role": "protector", "drugs": [], "mechanism": "Suppressed in balding scalp; HDAC1 overexpression counteracts cell-cycle dysregulation and senescence to rescue dermal papilla proliferation and follicle regeneration.", "evidence_paper_ids": [ "41506142" ], "n_evidence": 1, "mention_count": 0, "sources": [ "extract" ], "in_model": false, "uncertain": false, "structure": { "accession": "Q13547", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/Q13547", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-Q13547-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-Q13547-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/Q13547", "mean_plddt": 86.2, "plddt_band": "Confident (70–90)", "n_residues": 482, "local_pdb": "digital_twin\\data\\structures\\Q13547_AF.pdb" }, "uniprot": "Q13547", "uniprot_name": "Histone deacetylase 1", "length": 482, "function": "Histone deacetylase that catalyzes the deacetylation of lysine residues on the N-terminal part of the core histones (H2A, H2B, H3 and H4) (PubMed:16762839, PubMed:17704056, PubMed:28497810). Histone deacetylation gives a tag for epigenetic repression and plays an important role in transcriptional regulation, cell cycle progression and developmental events (PubMed:16762839, PubMed:17704056). Histone deacetylases act via the formation of large multiprotein complexes (PubMed:16762839, PubMed:17704056). Acts as a component of the histone deacetylase NuRD complex which participates in the remodelin", "pdb_count": 11, "pdb_ids": [ "4BKX", "5ICN", "6Z2J", "6Z2K", "7AO8", "7AO9", "7AOA", "7SME" ], "grounding": [ { "paper": "Deletion of hypoxia-inducible factor prolyl 4-hydroxylase 2 in FoxD1-lineage mesenchymal cells leads to congenital truncal alopecia", "quote": ".0 15.0 C Relative Hif-p4h-3 mRNA *** * ** * E18.5 P4 P8 P14 P16 P18 P21 P24 0.0 0.5 1.0 1.5 2.0 B Relative Hk2 mRNA * * ** A 250 130 100 70 P16 dorsal skin Ctrl cKO kDa HIF1α 55 HDAC1 250 130 100 70 P16 dorsal skin Ctrl cKO kDa HIF2α 55 HDAC1 Figure 4. HIF1α and HIF2α are stabilized, and expression", "n_hits": 3 }, { "paper": "ISEV2025 Abstract Book.", "quote": "microscopy confirmed the efficient intracellular delivery of miRNA_9985. Cell-signalling arrays and western blotting revealed that miRNA_9985-mediated GCC2 knockdown downregulated HDAC1 and BCL-2, ultimately leading to increased c-PARP levels, a marker of apoptosis. Co- immunoprecipitation assays re", "n_hits": 3 } ], "grounded_in_corpus": true }, { "gene": "HLA-DQB1", "name": "Major histocompatibility complex, class II, DQ beta 1", "diseases": [ "CIA" ], "pathway": "Other", "twin_node": "—", "effect": "?", "role": "modulator", "drugs": [], "mechanism": "Variants in HLA-DQB1 showed a non-significant trend toward persistent chemotherapy-induced alopecia despite scalp cooling, implicating MHC class II-mediated immune predisposition in impaired follicular recovery.", "evidence_paper_ids": [ "41224782" ], "n_evidence": 1, "mention_count": 0, "sources": [ "extract" ], "in_model": false, "uncertain": true, "structure": { "accession": "P01920", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/P01920", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-P01920-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-P01920-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/P01920", "mean_plddt": 86.9, "plddt_band": "Confident (70–90)", "n_residues": 261, "local_pdb": "digital_twin\\data\\structures\\P01920_AF.pdb" }, "uniprot": "P01920", "uniprot_name": "HLA class II histocompatibility antigen, DQ beta 1 chain", "length": 261, "function": "Binds peptides derived from antigens that access the endocytic route of antigen presenting cells (APC) and presents them on the cell surface for recognition by the CD4 T-cells. The peptide binding cleft accommodates peptides of 10-30 residues. The peptides presented by MHC class II molecules are generated mostly by degradation of proteins that access the endocytic route, where they are processed by lysosomal proteases and other hydrolases. Exogenous antigens that have been endocytosed by the APC are thus readily available for presentation via MHC II molecules, and for this reason this antigen ", "pdb_count": 10, "pdb_ids": [ "1JK8", "1S9V", "1UVQ", "2NNA", "4GG6", "4OZF", "4OZG", "4OZH" ], "grounding": [], "grounded_in_corpus": false }, { "gene": "HPGDS", "name": "Hematopoietic prostaglandin D synthase (Prostaglandin D2 synthase)", "diseases": [ "AGA" ], "pathway": "Prostaglandin", "twin_node": "APO", "effect": "+", "role": "driver", "drugs": [], "mechanism": "Produces prostaglandin D2 (PGD2), which is elevated in bald scalp and inhibits hair growth; cetirizine reduces PGD2 production.", "evidence_paper_ids": [ "41625414" ], "n_evidence": 1, "mention_count": 0, "sources": [ "extract" ], "in_model": false, "uncertain": false, "structure": { "accession": "O60760", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/O60760", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-O60760-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-O60760-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/O60760", "mean_plddt": 97.3, "plddt_band": "Very high (≥90)", "n_residues": 199, "local_pdb": "digital_twin\\data\\structures\\O60760_AF.pdb" }, "uniprot": "O60760", "uniprot_name": "Hematopoietic prostaglandin D synthase", "length": 199, "function": "Bifunctional enzyme which catalyzes both the conversion of PGH2 to PGD2, a prostaglandin involved in smooth muscle contraction/relaxation and a potent inhibitor of platelet aggregation, and the conjugation of glutathione with a wide range of aryl halides and organic isothiocyanates. Also exhibits low glutathione-peroxidase activity towards cumene hydroperoxide", "pdb_count": 30, "pdb_ids": [ "1IYH", "1IYI", "1V40", "2CVD", "2VCQ", "2VCW", "2VCX", "2VCZ" ], "grounding": [], "grounded_in_corpus": false }, { "gene": "HRH1", "name": "Histamine H1 receptor", "diseases": [ "AGA" ], "pathway": "Other", "twin_node": "—", "effect": "?", "role": "modulator", "drugs": [], "mechanism": "Targeted by the H1-antihistamine cetirizine, which exerts anti-inflammatory effects and reduces PGD2 to support hair growth in AGA.", "evidence_paper_ids": [ "41625414" ], "n_evidence": 1, "mention_count": 0, "sources": [ "extract" ], "in_model": false, "uncertain": false, "structure": { "accession": "P35367", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/P35367", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-P35367-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-P35367-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/P35367", "mean_plddt": 70.0, "plddt_band": "Low (50–70)", "n_residues": 487, "local_pdb": "digital_twin\\data\\structures\\P35367_AF.pdb" }, "uniprot": "P35367", "uniprot_name": "Histamine H1 receptor", "length": 487, "function": "G-protein-coupled receptor for histamine, a biogenic amine that functions as an immune modulator and a neurotransmitter (PubMed:33828102, PubMed:8280179). Through the H1 receptor, histamine mediates the contraction of smooth muscles and increases capillary permeability due to contraction of terminal venules. Also mediates neurotransmission in the central nervous system and thereby regulates circadian rhythms, emotional and locomotor activities as well as cognitive functions (By similarity)", "pdb_count": 3, "pdb_ids": [ "3RZE", "7DFL", "8YN2" ], "grounding": [], "grounded_in_corpus": false }, { "gene": "IGF1R", "name": "Insulin-like growth factor 1 receptor", "diseases": [ "AGA" ], "pathway": "Growth factor", "twin_node": "DP", "effect": "+", "role": "protector", "drugs": [], "mechanism": "Emerging AGA susceptibility/therapeutic target whose signaling supports dermal papilla function and hair follicle growth.", "evidence_paper_ids": [ "41769701" ], "n_evidence": 1, "mention_count": 0, "sources": [ "extract" ], "in_model": false, "uncertain": false, "structure": { "accession": "P08069", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/P08069", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-P08069-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-P08069-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/P08069", "mean_plddt": 78.0, "plddt_band": "Confident (70–90)", "n_residues": 1367, "local_pdb": "digital_twin\\data\\structures\\P08069_AF.pdb" }, "uniprot": "P08069", "uniprot_name": "Insulin-like growth factor 1 receptor", "length": 1367, "function": "Receptor tyrosine kinase which mediates actions of insulin-like growth factor 1 (IGF1). Binds IGF1 with high affinity and IGF2 and insulin (INS) with a lower affinity. The activated IGF1R is involved in cell growth and survival control. IGF1R is crucial for tumor transformation and survival of malignant cell. Ligand binding activates the receptor kinase, leading to receptor autophosphorylation, and tyrosines phosphorylation of multiple substrates, that function as signaling adapter proteins including, the insulin-receptor substrates (IRS1/2), Shc and 14-3-3 proteins. Phosphorylation of IRSs pr", "pdb_count": 45, "pdb_ids": [ "1IGR", "1JQH", "1K3A", "1M7N", "1P4O", "2OJ9", "2ZM3", "3D94" ], "grounding": [ { "paper": "Use of genetics in the prediction of success in male pattern hair loss therapy and mechanistic studies.", "quote": "effects of established therapies such as topical and oral minoxidil, finasteride, dutasteride, and prostaglandin-directed approaches. We also discuss emerging targets, including IGF1R, WNT10A, PPARGC1A, and prolactin receptor signalling, and examine how RNA based androgen receptor silencing and stem", "n_hits": 7 }, { "paper": "Self-assembling peptide inspired by insulin and type 1 insulin-like growth factor for the treatment of androgenetic alopecia", "quote": "Bioactive Materials 53 (2025) 819–830 829 [13] M. Castela, F. Linay, E. Roy, P. Moguelet, J. Xu, M. Holzenberger, K. Khosrotehrani, S. Aractingi, Igf1r signalling acts on the anagen-to-catagen transition in the hair cycle, Exp. Dermatol. 26 (2017) 785–791. [14] R. Panchaprateep, P. Asawanonda, Insul", "n_hits": 2 } ], "grounded_in_corpus": true }, { "gene": "IGHE", "name": "Immunoglobulin heavy constant epsilon (IgE)", "diseases": [ "AA" ], "pathway": "Other", "twin_node": "—", "effect": "?", "role": "modulator", "drugs": [], "mechanism": "Elevated serum IgE (Th2/atopic axis) correlates with greater treatment efficacy in AA patients with atopic dermatitis, marking an atopic AA endotype.", "evidence_paper_ids": [ "41608924" ], "n_evidence": 1, "mention_count": 0, "sources": [ "extract" ], "in_model": false, "uncertain": true, "structure": { "accession": "P01854", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/P01854", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-P01854-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-P01854-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/P01854", "mean_plddt": 76.5, "plddt_band": "Confident (70–90)", "n_residues": 546, "local_pdb": "digital_twin\\data\\structures\\P01854_AF.pdb" }, "uniprot": "P01854", "uniprot_name": "Immunoglobulin heavy constant epsilon", "length": 546, "function": "Constant region of immunoglobulin heavy chains. Immunoglobulins, also known as antibodies, are membrane-bound or secreted glycoproteins produced by B lymphocytes. In the recognition phase of humoral immunity, the membrane-bound immunoglobulins serve as receptors which, upon binding of a specific antigen, trigger the clonal expansion and differentiation of B lymphocytes into immunoglobulins-secreting plasma cells. Secreted immunoglobulins mediate the effector phase of humoral immunity, which results in the elimination of bound antigens (PubMed:20176268, PubMed:22158414). The antigen binding sit", "pdb_count": 35, "pdb_ids": [ "1F6A", "1FP5", "1G84", "1O0V", "2WQR", "2Y7Q", "3H9Y", "3H9Z" ], "grounding": [], "grounded_in_corpus": false }, { "gene": "IL10", "name": "Interleukin 10", "diseases": [ "AA", "CIA" ], "pathway": "Other", "twin_node": "—", "effect": "?", "role": "protector", "drugs": [], "mechanism": "γδTreg-secreted IL-10 suppresses pathogenic T-cell activity and helps restore hair-follicle immune privilege in AA.", "evidence_paper_ids": [ "41579939", "PPR1114305" ], "n_evidence": 2, "mention_count": 0, "sources": [ "extract" ], "in_model": false, "uncertain": false, "structure": { "accession": "P22301", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/P22301", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-P22301-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-P22301-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/P22301", "mean_plddt": 87.9, "plddt_band": "Confident (70–90)", "n_residues": 178, "local_pdb": "digital_twin\\data\\structures\\P22301_AF.pdb" }, "uniprot": "P22301", "uniprot_name": "Interleukin-10", "length": 178, "function": "Major immune regulatory cytokine that acts on many cells of the immune system where it has profound anti-inflammatory functions, limiting excessive tissue disruption caused by inflammation. Mechanistically, IL10 binds to its heterotetrameric receptor comprising IL10RA and IL10RB leading to JAK1 and STAT2-mediated phosphorylation of STAT3 (PubMed:16982608). In turn, STAT3 translocates to the nucleus where it drives expression of anti-inflammatory mediators (PubMed:18025162). Targets antigen-presenting cells (APCs) such as macrophages and monocytes and inhibits their release of pro-inflammatory ", "pdb_count": 9, "pdb_ids": [ "1ILK", "1INR", "1J7V", "1LK3", "1Y6K", "2H24", "2ILK", "6X93" ], "grounding": [ { "paper": "Alopecia in IL-10-deficient Mouse Pups is c-Kit-Dependent and Can Be Triggered by Iron Deficiency", "quote": "vironmental causes. This investigation was undertaken to determine the mechanisms underlying the sporadic development of alopecia in litters from C57BL/6 interleukin-10-deficient (Il10−/−) mice. All pups in affected litters demonstrated alopecia by postnatal days 17–19, with hair loss from their tru", "n_hits": 67 }, { "paper": "A mouse model of clonal CD8+ T lymphocyte-mediated alopecia areata progressing to alopecia universalis", "quote": "ss I and not class II MHC-dependent. Pathologic T cells primarily express IFNG and IL17 early in disease, with dramatic increases in cytokine production and recruitment of IL4 and IL10 production with disease progression. Inhibition of individual cytokines did not significantly alter disease inciden", "n_hits": 12 }, { "paper": "Immunoregulatory Effects of Myeloid-Derived Suppressor Cell Exosomes in Mouse Model of Autoimmune Alopecia Areata", "quote": "utes to ζ-chain downregulation, and iNOS, which induces NO. NO and ROS inhibit T cell prolif­ eration and induce apoptosis. HO-1 inhibits T cell proliferation via CO production. IL10 promotes TH2 deviation and type 2 macrophage (Mϕ) polarization. Membrane-bound TGFβ1 sup­ ports NK cell anergy and in", "n_hits": 11 }, { "paper": "ISEV2025 Abstract Book.", "quote": "free circulating cytokines and cytokine gene expression from the tumour tissue of the same patients (n = 22). Results: We identified three EV-associated cytokines, interleukin 10 (IL10), interleukin 12 (IL12) and interferon gamma inducible protein 10 (IP10) as significantly higher in BC patients at ", "n_hits": 2 } ], "grounded_in_corpus": true }, { "gene": "IL13", "name": "Interleukin 13", "diseases": [ "AA" ], "pathway": "Other", "twin_node": "—", "effect": "?", "role": "driver", "drugs": [], "mechanism": "IL-13, a Th2 cytokine, is upregulated in lesional AA CD4+ T cells reflecting Th2 skewing that accompanies the dominant Th1 response in disease pathogenesis.", "evidence_paper_ids": [ "41740930" ], "n_evidence": 1, "mention_count": 0, "sources": [ "extract" ], "in_model": false, "uncertain": false, "structure": { "accession": "P35225", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/P35225", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-P35225-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-P35225-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/P35225", "mean_plddt": 85.6, "plddt_band": "Confident (70–90)", "n_residues": 146, "local_pdb": "digital_twin\\data\\structures\\P35225_AF.pdb" }, "uniprot": "P35225", "uniprot_name": "Interleukin-13", "length": 146, "function": "Cytokine that plays important roles in allergic inflammation and immune response to parasite infection (PubMed:8096327, PubMed:8097324). Synergizes with IL2 in regulating interferon-gamma synthesis (PubMed:8096327). Stimulates B-cell proliferation, and activation of eosinophils, basophils, and mast cells (PubMed:7903680, PubMed:8759755). Plays an important role in controlling IL33 activity by modulating the production of transmembrane and soluble forms of interleukin-1 receptor-like 1/IL1RL1 (By similarity). Displays the capacity to antagonize Th1-driven proinflammatory immune response and dow", "pdb_count": 13, "pdb_ids": [ "1GA3", "1IJZ", "1IK0", "3BPO", "3G6D", "3L5W", "3L5X", "3LB6" ], "grounding": [ { "paper": "JAK-STAT1 as therapeutic target for EGFR deficiency-associated inflammation and scarring alopecia", "quote": "air follicle cell compartments (Fig. 4D). This captured the multifaceted inflammatory microenvironment in EGFRΔEgr2 mice, with prominent Il17-producing γδT cells and ILC3s, Il4 and Il13 producing CD4 Th2 cells and ILC2s, Ifnγ producing CD8 T-cells and NK cells and IL1α/β and OSM expressing macrophage", "n_hits": 4 } ], "grounded_in_corpus": true }, { "gene": "IL13RA1", "name": "Interleukin 13 receptor subunit alpha 1", "diseases": [ "AA" ], "pathway": "Other", "twin_node": "—", "effect": "?", "role": "driver", "drugs": [], "mechanism": "IL13RA1 is upregulated in lesional AA, marking Th2-axis activation and IL-13 responsiveness in affected scalp cells.", "evidence_paper_ids": [ "41740930" ], "n_evidence": 1, "mention_count": 0, "sources": [ "extract" ], "in_model": false, "uncertain": false, "structure": { "accession": "P78552", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/P78552", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-P78552-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-P78552-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/P78552", "mean_plddt": 81.6, "plddt_band": "Confident (70–90)", "n_residues": 427, "local_pdb": "digital_twin\\data\\structures\\P78552_AF.pdb" }, "uniprot": "P78552", "uniprot_name": "Interleukin-13 receptor subunit alpha-1", "length": 427, "function": "Binds with low affinity to interleukin-13 (IL13). Together with IL4RA can form a functional receptor for IL13. Also serves as an alternate accessory protein to the common cytokine receptor gamma chain for interleukin-4 (IL4) signaling, but cannot replace the function of IL2RG in allowing enhanced interleukin-2 (IL2) binding activity", "pdb_count": 4, "pdb_ids": [ "3BPN", "3BPO", "4HWB", "5E4E" ], "grounding": [], "grounded_in_corpus": false }, { "gene": "IL1B", "name": "Interleukin-1 beta", "diseases": [ "CIA" ], "pathway": "Other", "twin_node": "—", "effect": "?", "role": "driver", "drugs": [], "mechanism": "Pro-inflammatory cytokine raised during chemotherapy-induced hair-follicle injury; its downregulation correlates with attenuated alopecia.", "evidence_paper_ids": [ "41615374", "PPR1114305" ], "n_evidence": 2, "mention_count": 0, "sources": [ "extract" ], "in_model": false, "uncertain": false, "structure": { "accession": "P01584", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/P01584", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-P01584-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-P01584-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/P01584", "mean_plddt": 76.2, "plddt_band": "Confident (70–90)", "n_residues": 269, "local_pdb": "digital_twin\\data\\structures\\P01584_AF.pdb" }, "uniprot": "P01584", "uniprot_name": "Interleukin-1 beta", "length": 269, "function": "Potent pro-inflammatory cytokine (PubMed:10653850, PubMed:12794819, PubMed:28331908, PubMed:3920526). Initially discovered as the major endogenous pyrogen, induces prostaglandin synthesis, neutrophil influx and activation, T-cell activation and cytokine production, B-cell activation and antibody production, and fibroblast proliferation and collagen production (PubMed:3920526). Promotes Th17 differentiation of T-cells. Synergizes with IL12/interleukin-12 to induce IFNG synthesis from T-helper 1 (Th1) cells (PubMed:10653850). Plays a role in angiogenesis by inducing VEGF production synergistical", "pdb_count": 64, "pdb_ids": [ "1HIB", "1I1B", "1IOB", "1ITB", "1L2H", "1S0L", "1T4Q", "1TOO" ], "grounding": [ { "paper": "ISEV2025 Abstract Book.", "quote": "dynamin-dependent endocytosis mechanism. EV129 downregulated TLR4, C-JUN and NFkB gene expression, leading to a reduction in the expression of the pro- inflammatory cytokines IL8, IL1b and TNF in inflamed HT-29 cells. EV129 also downregulated IRF3 and IRF5 gene expression in inflamed HT-29 cells and", "n_hits": 2 }, { "paper": "Promotion of Hair Regrowth in Androgenetic Alopecia with Supplemented Erzhi Wan Exploring Its Mechanism Using Network Pharmacology and Molecular Docking", "quote": "etin MYC Mohanlian MOL000098 Quercetin F3 Mohanlian MOL000098 Quercetin GJA1 Mohanlian MOL000098 Quercetin CYP1A1 Mohanlian MOL000098 Quercetin ICAM1 Mohanlian MOL000098 Quercetin IL1B Mohanlian MOL000098 Quercetin CCL2 Mohanlian MOL000098 Quercetin SELE (Continued) Clinical, Cosmetic and Investigat", "n_hits": 2 } ], "grounded_in_corpus": true }, { "gene": "IL23A", "name": "Interleukin 23 subunit alpha", "diseases": [ "AA", "Other" ], "pathway": "Other", "twin_node": "—", "effect": "?", "role": "modulator", "drugs": [], "mechanism": "IL-23 inhibition (tildrakizumab) for psoriasis was temporally associated with paradoxical new-onset AA, implicating IL-23 pathway modulation in unmasking autoimmune follicular inflammation.", "evidence_paper_ids": [ "41614228" ], "n_evidence": 1, "mention_count": 0, "sources": [ "extract" ], "in_model": false, "uncertain": false, "structure": { "accession": "Q9NPF7", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/Q9NPF7", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-Q9NPF7-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-Q9NPF7-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/Q9NPF7", "mean_plddt": 80.6, "plddt_band": "Confident (70–90)", "n_residues": 189, "local_pdb": "digital_twin\\data\\structures\\Q9NPF7_AF.pdb" }, "uniprot": "Q9NPF7", "uniprot_name": "Interleukin-23 subunit alpha", "length": 189, "function": "Associates with IL12B to form the pro-inflammatory cytokine IL-23 that plays different roles in innate and adaptive immunity (PubMed:11114383). Released by antigen-presenting cells such as dendritic cells or macrophages, binds to a heterodimeric receptor complex composed of IL12RB1 and IL23R to activate JAK2 and TYK2 which then phosphorylate the receptor to form a docking site leading to the phosphorylation of STAT3 and STAT4 (PubMed:29287995, PubMed:32474165, PubMed:33606986). This process leads to activation of several pathways including p38 MAPK or NF-kappa-B and promotes the production of ", "pdb_count": 15, "pdb_ids": [ "3D85", "3D87", "3DUH", "3QWR", "4GRW", "5MJ3", "5MJ4", "5MXA" ], "grounding": [], "grounded_in_corpus": false }, { "gene": "IL4R", "name": "Interleukin 4 receptor", "diseases": [ "AA" ], "pathway": "Other", "twin_node": "—", "effect": "?", "role": "driver", "drugs": [], "mechanism": "IL4R upregulation in lesional AA CD4+ and regulatory T cells reflects Th2 skewing contributing to the inflammatory milieu in AA.", "evidence_paper_ids": [ "41608924", "41740930" ], "n_evidence": 2, "mention_count": 0, "sources": [ "extract" ], "in_model": false, "uncertain": false, "structure": { "accession": "P24394", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/P24394", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-P24394-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-P24394-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/P24394", "mean_plddt": 54.8, "plddt_band": "Low (50–70)", "n_residues": 825, "local_pdb": "digital_twin\\data\\structures\\P24394_AF.pdb" }, "uniprot": "P24394", "uniprot_name": "Interleukin-4 receptor subunit alpha", "length": 825, "function": "Receptor for both interleukin 4 and interleukin 13 (PubMed:17030238). Couples to the JAK1/2/3-STAT6 pathway. The IL4 response is involved in promoting Th2 differentiation. The IL4/IL13 responses are involved in regulating IgE production and, chemokine and mucus production at sites of allergic inflammation. In certain cell types, can signal through activation of insulin receptor substrates, IRS1/IRS2", "pdb_count": 10, "pdb_ids": [ "1IAR", "1IRS", "3BPL", "3BPN", "3BPO", "5E4E", "6OEL", "6WGL" ], "grounding": [], "grounded_in_corpus": false }, { "gene": "IL6", "name": "Interleukin-6", "diseases": [ "AGA", "CIA" ], "pathway": "JAK-STAT", "twin_node": "INF", "effect": "+", "role": "driver", "drugs": [], "mechanism": "DHT increases pro-inflammatory IL-6 in dermal papilla cells contributing to a hair-suppressive microenvironment; lowered by CYP19A1/MitoQ.", "evidence_paper_ids": [ "41571202", "41615374" ], "n_evidence": 2, "mention_count": 0, "sources": [ "extract" ], "in_model": false, "uncertain": false, "structure": { "accession": "P05231", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/P05231", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-P05231-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-P05231-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/P05231", "mean_plddt": 85.3, "plddt_band": "Confident (70–90)", "n_residues": 212, "local_pdb": "digital_twin\\data\\structures\\P05231_AF.pdb" }, "uniprot": "P05231", "uniprot_name": "Interleukin-6", "length": 212, "function": "Cytokine with a wide variety of biological functions in immunity, tissue regeneration, and metabolism. Binds to IL6R, then the complex associates to the signaling subunit IL6ST/gp130 to trigger the intracellular IL6-signaling pathway (Probable). The interaction with the membrane-bound IL6R and IL6ST stimulates 'classic signaling', whereas the binding of IL6 and soluble IL6R to IL6ST stimulates 'trans-signaling'. Alternatively, 'cluster signaling' occurs when membrane-bound IL6:IL6R complexes on transmitter cells activate IL6ST receptors on neighboring receiver cells (Probable)", "pdb_count": 17, "pdb_ids": [ "1ALU", "1IL6", "1P9M", "2IL6", "4CNI", "4J4L", "4NI7", "4NI9" ], "grounding": [ { "paper": "Immunoregulatory Effects of Myeloid-Derived Suppressor Cell Exosomes in Mouse Model of Autoimmune Alopecia Areata", "quote": "8+ T cells, transfer studies supporting a specific contribution of both CD8+ and CD4+ T cells (49). AA induction also relies on expansion of TH17, which abundantly secrete TGFβ, IL6, and IL1β (50). TH17 inversely correlate with CD4+CD25+FoxP3+ Treg (51), which inhibit contact-dependent T cell prolif", "n_hits": 9 }, { "paper": "ISEV2025 Abstract Book.", "quote": "cell EVs by primary TECs in a phosphatidylserine (PtdSer)-dependent manner. Importantly, B cell EVs deliver EBERs into endosomes of primary TECs, driving IFN gamma, TNF alpha and IL6 production through TLR3 activation. Summary/Conclusion: In SLE patients, blood cell-derived inflammatory EVs target T", "n_hits": 6 }, { "paper": "Genetic analysis of a novel antioxidant multi-target iron chelator, M30 protecting against chemotherapy-induced alopecia in mice", "quote": "CTX/ Normal MC/ CTX Tbx4 0.167 4.913 Ifi27l2a 0.165 1.675 Dmbt1 0.122 3.491 Ccl6 0.079 3.826 Spi1 0.163 3.851 Ccl2 0.137 2.583 Slc11a1 0.107 5.273 Ccl7 0.073 4.394 Nov 0.162 4.204 Il6 0.086 4.170 Enpep 0.103 8.165 Retnlg 0.047 21.223 Ccl2 0.137 2.583 Pot1b 0.067 2.010 Gapt 0.086 5.105 Ccl24 0.043 8.", "n_hits": 5 }, { "paper": "Subcutaneous injection of genetically engineered exosomes for androgenic alopecia treatment", "quote": "Cs exhibiting a follicular miniaturization phenotype, including loss of replicative potential, reduction of molecular markers and secretion of inhibitory factors, such as DKK1 and IL6 (Premanand and Reena Rajkumari, 2018). DKK1 functions as a negative regulator of the WNT signaling pathway, whereas ", "n_hits": 3 } ], "grounded_in_corpus": true }, { "gene": "INS", "name": "Insulin", "diseases": [ "AGA" ], "pathway": "Growth factor", "twin_node": "DP", "effect": "?", "role": "modulator", "drugs": [], "mechanism": "Identified as a key AGA-associated node in PPI network analysis, linking metabolic/insulin signaling to follicle biology.", "evidence_paper_ids": [ "PPR1134993" ], "n_evidence": 1, "mention_count": 0, "sources": [ "extract" ], "in_model": false, "uncertain": false, "structure": { "accession": "P01308", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/P01308", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-P01308-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-P01308-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/P01308", "mean_plddt": 52.9, "plddt_band": "Low (50–70)", "n_residues": 110, "local_pdb": "digital_twin\\data\\structures\\P01308_AF.pdb" }, "uniprot": "P01308", "uniprot_name": "Insulin", "length": 110, "function": "Insulin decreases blood glucose concentration. It increases cell permeability to monosaccharides, amino acids and fatty acids. It accelerates glycolysis, the pentose phosphate cycle, and glycogen synthesis in liver", "pdb_count": 367, "pdb_ids": [ "1A7F", "1AI0", "1AIY", "1B9E", "1BEN", "1EFE", "1EV3", "1EV6" ], "grounding": [ { "paper": "ISEV2025 Abstract Book.", "quote": "l as lung, liver, bone, and blood (mouse) as a panel of common target tissues (Figure 1). We utilized the miRNA Next-Generation-Sequencing Discovery Assay (miND), which uses spike-ins to enable absolute quantitation of small RNAs, including miRNAs. Results: We identified a cluster of miRNAs with sig", "n_hits": 9 }, { "paper": "Keratin 17 null mice exhibit age- and strain-dependent alopecia", "quote": "correspond to the first hair being produced by follicles. The identity of the primary antibody used is indicated at left. Mono- clonal antibody AE13 recognizes hard type I kerat- ins and is used as loading control. Lane P refers to purified recombinant K17 or K16 proteins in the relevant blots. In t", "n_hits": 2 }, { "paper": "Keratin 17 null mice exhibit ageand strain-dependent alopecia", "quote": "correspond to the first hair being produced by follicles. The identity of the primary antibody used is indicated at left. Mono- clonal antibody AE13 recognizes hard type I kerat- ins and is used as loading control. Lane P refers to purified recombinant K17 or K16 proteins in the relevant blots. In t", "n_hits": 2 } ], "grounded_in_corpus": true }, { "gene": "KDR", "name": "VEGFR2 / fetal liver kinase-1 (Flk-1)", "diseases": [ "CIA" ], "pathway": "Growth factor", "twin_node": "DP", "effect": "+", "role": "protector", "drugs": [], "mechanism": "Flk-1/VEGFR2 mediates VEGF-driven follicular angiogenesis; its downregulation by 5-FU reduces blood supply to hair follicles.", "evidence_paper_ids": [ "39922517" ], "n_evidence": 1, "mention_count": 0, "sources": [ "extract" ], "in_model": false, "uncertain": false, "structure": { "accession": "P35968", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/P35968", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-P35968-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-P35968-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/P35968", "mean_plddt": 71.1, "plddt_band": "Confident (70–90)", "n_residues": 1356, "local_pdb": "digital_twin\\data\\structures\\P35968_AF.pdb" }, "uniprot": "P35968", "uniprot_name": "Vascular endothelial growth factor receptor 2", "length": 1356, "function": "Tyrosine-protein kinase that acts as a cell-surface receptor for VEGFA, VEGFC and VEGFD. Plays an essential role in the regulation of angiogenesis, vascular development, vascular permeability, and embryonic hematopoiesis. Promotes proliferation, survival, migration and differentiation of endothelial cells. Promotes reorganization of the actin cytoskeleton. Isoforms lacking a transmembrane domain, such as isoform 2 and isoform 3, may function as decoy receptors for VEGFA, VEGFC and/or VEGFD. Isoform 2 plays an important role as negative regulator of VEGFA- and VEGFC-mediated lymphangiogenesis b", "pdb_count": 54, "pdb_ids": [ "1VR2", "1Y6A", "1Y6B", "1YWN", "2M59", "2MET", "2MEU", "2OH4" ], "grounding": [ { "paper": "Effects of Baicalin on Alopecia and the Associated Mechanism", "quote": "0 LGALS3 ANXA5 ITK CTSG TYMS CTSD SOD2 CA2TGM2RNASE3 SHBG PIK3CG C1S C1R RAC2 HADH SHMT1 F10 SNRPA PPARA GC TPH1 RXRA CASP7 CFD AHCY DCK XIAP CHIT1 NR1H2 MMP13 MMP1 APCS TYMP CMA1 KDR LCK MDM2 IL2 SYK PGR ESR2 SRC HSP90AA1 PTPN11 AKT1 ESR1 TTR FGFR2 DHODH STS DHFR OTC LTA4H PLK1 CFB NMNAT1 CYP19A1 T", "n_hits": 2 } ], "grounded_in_corpus": true }, { "gene": "KL", "name": "Klotho", "diseases": [ "AGA" ], "pathway": "Other", "twin_node": "—", "effect": "?", "role": "protector", "drugs": [], "mechanism": "Tier-1 AGA therapeutic target from integrative multi-omics; anti-aging factor implicated in protecting against follicle senescence.", "evidence_paper_ids": [ "41285252" ], "n_evidence": 1, "mention_count": 0, "sources": [ "extract" ], "in_model": false, "uncertain": false, "structure": { "accession": "Q9UEF7", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/Q9UEF7", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-Q9UEF7-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-Q9UEF7-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/Q9UEF7", "mean_plddt": 89.1, "plddt_band": "Confident (70–90)", "n_residues": 1012, "local_pdb": "digital_twin\\data\\structures\\Q9UEF7_AF.pdb" }, "uniprot": "Q9UEF7", "uniprot_name": "Klotho", "length": 1012, "function": "May have weak glycosidase activity towards glucuronylated steroids. However, it lacks essential active site Glu residues at positions 239 and 872, suggesting it may be inactive as a glycosidase in vivo. May be involved in the regulation of calcium and phosphorus homeostasis by inhibiting the synthesis of active vitamin D (By similarity). Essential factor for the specific interaction between FGF23 and FGFR1 (By similarity)", "pdb_count": 6, "pdb_ids": [ "5W21", "7YSH", "7YSU", "7YSW", "8TOH", "8UF8" ], "grounding": [], "grounded_in_corpus": false }, { "gene": "KLRK1", "name": "Killer cell lectin-like receptor K1 (NKG2D)", "diseases": [ "AA" ], "pathway": "Other", "twin_node": "—", "effect": "?", "role": "driver", "drugs": [ "anti-NKG2D (investigational)", "anti-NKG2D antibodies (investigational)" ], "mechanism": "NKG2D on pathogenic CD8+ T cells binds MICA/B on hair follicles to mediate cytotoxic destruction and immune privilege collapse in AA.", "evidence_paper_ids": [ "41579939" ], "n_evidence": 1, "mention_count": 0, "sources": [ "discover:AA", "discover:recent", "extract" ], "in_model": false, "uncertain": false, "structure": { "accession": "P26718", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/P26718", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-P26718-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-P26718-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/P26718", "mean_plddt": 79.2, "plddt_band": "Confident (70–90)", "n_residues": 216, "local_pdb": "digital_twin\\data\\structures\\P26718_AF.pdb" }, "uniprot": "P26718", "uniprot_name": "NKG2-D type II integral membrane protein", "length": 216, "function": "Functions as an activating and costimulatory receptor involved in immunosurveillance upon binding to various cellular stress-inducible ligands displayed at the surface of autologous tumor cells and virus-infected cells. Provides both stimulatory and costimulatory innate immune responses on activated killer (NK) cells, leading to cytotoxic activity. Acts as a costimulatory receptor for T-cell receptor (TCR) in CD8(+) T-cell-mediated adaptive immune responses by amplifying T-cell activation. Stimulates perforin-mediated elimination of ligand-expressing tumor cells. Signaling involves calcium inf", "pdb_count": 8, "pdb_ids": [ "1HYR", "1KCG", "1MPU", "4PDC", "4S0U", "8TM0", "8TM2", "9DH2" ], "grounding": [ { "paper": "Impaired autophagy promotes hair loss in the C3H HeJ mouse model of alopecia areata", "quote": "(alopecia universalis) [6]. Our genome- wide association studies (GWAS) followed by functional studies in the C3H/HeJ mouse model of AA demonstrated the promi­ nent role of CD8+ KLRK1/NKG2D+ cytotoxic T cells as patho­ genic effector T cells in both C3H/HeJ grafted AA mice and AA patients [7,8]. Des", "n_hits": 7 }, { "paper": "JAK-STAT1 as therapeutic target for EGFR deficiency-associated inflammation and scarring alopecia", "quote": "03 103 104 105 0 -10 3 103 104 105 0,64 0 -103 103 104 105 0 -10 3 103 104 105 WT IgG ydTC Bulge CD4 ILC3 DP ILC2 CD8 CL SG LC_MHC2 Tregs DETC FB NK Mac CycIC Mel LC_Rtn1 uHF Pfn1 Klrk1 Cd2 Tmsb4x Coro1a Lgals1 Cd3e Fau Tmsb10 Klrd1 Ctla2a Lat Cd3g Cd52 Lck Ccl4 Cd3d Thy1 Klrc1 Ifng Rac2 Ly6c2 Hcst ", "n_hits": 2 } ], "grounded_in_corpus": true }, { "gene": "KRT81", "name": "Hair keratin (type II)", "diseases": [ "AGA" ], "pathway": "Other", "twin_node": "—", "effect": "?", "role": "modulator", "drugs": [], "mechanism": "Hair shaft keratin showing structural and amino-acid composition alterations (cysteine, beta-sheet/alpha-helix shifts) in AGA hair as candidate biomarkers.", "evidence_paper_ids": [ "41485678" ], "n_evidence": 1, "mention_count": 0, "sources": [ "extract" ], "in_model": false, "uncertain": true, "structure": { "accession": "Q14533", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/Q14533", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-Q14533-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-Q14533-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/Q14533", "mean_plddt": 71.9, "plddt_band": "Confident (70–90)", "n_residues": 505, "local_pdb": "digital_twin\\data\\structures\\Q14533_AF.pdb" }, "uniprot": "Q14533", "uniprot_name": "Keratin, type II cuticular Hb1", "length": 505, "function": "", "pdb_count": 0, "pdb_ids": [], "grounding": [ { "paper": "iTRAQ-based quantitative proteomics revealing the therapeutic mechanism of a medicinal and edible formula YH0618 in reducing doxorubicin-induced alopecia by targeting and TGF-b Smad3 pathway", "quote": "fection, estrogen signaling route, pyruvate metabolism, chemical carci­ nogenesis, and PPAR signaling pathway. The results of Western blot revealed that the levels of keratin 81 (Krt81), keratin 34 (Krt34), keratin 33a (Krt33a), and Sma and MAD-related protein 3 (Smad3) were upregulated in response ", "n_hits": 14 }, { "paper": "iTRAQ-based quantitative proteomics revealing the therapeutic mechanism of a medicinal and edible formula YH0618 in reducing doxorubicin-induced alopecia by targeting keratins and TGF-β Smad3 pathway", "quote": "fection, estrogen signaling route, pyruvate metabolism, chemical carci­ nogenesis, and PPAR signaling pathway. The results of Western blot revealed that the levels of keratin 81 (Krt81), keratin 34 (Krt34), keratin 33a (Krt33a), and Sma and MAD-related protein 3 (Smad3) were upregulated in response ", "n_hits": 14 } ], "grounded_in_corpus": true }, { "gene": "LAMC1", "name": "Laminin subunit gamma-1", "diseases": [ "AGA" ], "pathway": "Other", "twin_node": "—", "effect": "?", "role": "modulator", "drugs": [], "mechanism": "Tier-3 multi-omics AGA candidate; extracellular-matrix laminin component supporting follicle basement membrane integrity.", "evidence_paper_ids": [ "41285252" ], "n_evidence": 1, "mention_count": 0, "sources": [ "extract" ], "in_model": false, "uncertain": false, "structure": { "accession": "P11047", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/P11047", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-P11047-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-P11047-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/P11047", "mean_plddt": 76.4, "plddt_band": "Confident (70–90)", "n_residues": 1609, "local_pdb": "digital_twin\\data\\structures\\P11047_AF.pdb" }, "uniprot": "P11047", "uniprot_name": "Laminin subunit gamma-1", "length": 1609, "function": "Binding to cells via a high affinity receptor, laminin is thought to mediate the attachment, migration and organization of cells into tissues during embryonic development by interacting with other extracellular matrix components. As a subunit of laminin-1 (also known as laminin-111 or EHS laminin), it is involved in the stimulation of agrin-induced receptor clustering through a MuSK-independent pathway", "pdb_count": 4, "pdb_ids": [ "5XAU", "7CEC", "8DMK", "9AZ3" ], "grounding": [ { "paper": "Laminin-511, inducer of hair growth, is down-regulated and its suppressor in hair growth, laminin-332 up-regulated in chemotherapy-induced alopecia", "quote": "Difference in a modified ANOVA test. Nucleotide sequences for primers or probes in the Taqman reaction for Lama3a, Lamb3 and Lamc2 subunits (laminin-332) and for Lama5, Lamb1 and Lamc1 subunits (laminin-511) were reported previously [18]. 2.4. In situ hybridization Detection of mRNA in tissue specim", "n_hits": 2 } ], "grounded_in_corpus": true }, { "gene": "LAMC3", "name": "Laminin subunit gamma-3", "diseases": [ "AGA" ], "pathway": "Other", "twin_node": "—", "effect": "?", "role": "modulator", "drugs": [], "mechanism": "Tier-3 multi-omics AGA candidate; extracellular-matrix laminin implicated in follicular niche structure.", "evidence_paper_ids": [ "41285252" ], "n_evidence": 1, "mention_count": 0, "sources": [ "extract" ], "in_model": false, "uncertain": false, "structure": { "accession": "Q9Y6N6", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/Q9Y6N6", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-Q9Y6N6-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-Q9Y6N6-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/Q9Y6N6", "mean_plddt": 74.8, "plddt_band": "Confident (70–90)", "n_residues": 1575, "local_pdb": "digital_twin\\data\\structures\\Q9Y6N6_AF.pdb" }, "uniprot": "Q9Y6N6", "uniprot_name": "Laminin subunit gamma-3", "length": 1575, "function": "Binding to cells via a high affinity receptor, laminin is thought to mediate the attachment, migration and organization of cells into tissues during embryonic development by interacting with other extracellular matrix components", "pdb_count": 0, "pdb_ids": [], "grounding": [ { "paper": "Molecular signatures and signaling interactions of the hair follicle stem cell niche.", "quote": "2006) possibly ensuring proper structural integrity of the DP. Presence of uniquely enriched adhesion and extracellular matrix genes, such as Adamts4, Cdh11, Col13a1, Lama2 and Lamc3, suggested that the DP shapes its own extracellular environment. As previously described for morphogenetic anagen aft", "n_hits": 2 } ], "grounded_in_corpus": true }, { "gene": "MAPK1", "name": "Mitogen-activated protein kinase 1 (ERK2 / MAPK signaling)", "diseases": [ "AGA" ], "pathway": "Other", "twin_node": "—", "effect": "?", "role": "driver", "drugs": [], "mechanism": "MAPK signaling is enriched among AGA targets; Xiaozhi Yufa decoction suppresses MAPK pathway activation to ameliorate androgenetic alopecia.", "evidence_paper_ids": [ "41394121" ], "n_evidence": 1, "mention_count": 0, "sources": [ "extract" ], "in_model": false, "uncertain": false, "structure": { "accession": "P28482", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/P28482", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-P28482-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-P28482-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/P28482", "mean_plddt": 90.4, "plddt_band": "Very high (≥90)", "n_residues": 360, "local_pdb": "digital_twin\\data\\structures\\P28482_AF.pdb" }, "uniprot": "P28482", "uniprot_name": "Mitogen-activated protein kinase 1", "length": 360, "function": "Serine/threonine kinase which acts as an essential component of the MAP kinase signal transduction pathway. MAPK1/ERK2 and MAPK3/ERK1 are the 2 MAPKs which play an important role in the MAPK/ERK cascade. They participate also in a signaling cascade initiated by activated KIT and KITLG/SCF. Depending on the cellular context, the MAPK/ERK cascade mediates diverse biological functions such as cell growth, adhesion, survival and differentiation through the regulation of transcription, translation, cytoskeletal rearrangements. The MAPK/ERK cascade also plays a role in initiation and regulation of m", "pdb_count": 157, "pdb_ids": [ "1PME", "1TVO", "1WZY", "2OJG", "2OJI", "2OJJ", "2Y9Q", "3D42" ], "grounding": [ { "paper": "Promotion of Hair Regrowth in Androgenetic Alopecia with Supplemented Erzhi Wan Exploring Its Mechanism Using Network Pharmacology and Molecular Docking", "quote": "olin BCL2L1 Mohanlian MOL000006 Luteolin CDKN1A Mohanlian MOL000006 Luteolin CASP9 Mohanlian MOL000006 Luteolin MMP2 Mohanlian MOL000006 Luteolin MMP9 Mohanlian MOL000006 Luteolin MAPK1 Mohanlian MOL000006 Luteolin IL10RA Mohanlian MOL000006 Luteolin RB1 Mohanlian MOL000006 Luteolin CDK4 Mohanlian M", "n_hits": 4 }, { "paper": "Exploring the Efficacy and Potential Mechanisms of Topical Periplaneta americana (L.) Extract in Treating Androgenetic Alopecia in a Mouse Model A Systems Pharmacology and Skin Microbiome Analysis", "quote": "the default screening conditions of the Centiscape 2.2 software plug-in, the interaction network between 24 core protein nodes and 157 edges was screened (Figure 2C). Among them, MAPK1, Bcl-2, Akt, ESR1, and other core proteins that play a positive role in AGA therapy had strong correlations. Figure", "n_hits": 3 } ], "grounded_in_corpus": true }, { "gene": "MAPK8", "name": "c-Jun N-terminal kinase (JNK)", "diseases": [ "CIA" ], "pathway": "Other", "twin_node": "—", "effect": "?", "role": "modulator", "drugs": [], "mechanism": "5-FU activates JNK in dermal papilla cells, but pharmacologic inhibition does not prevent cell death, indicating indirect involvement in CIA.", "evidence_paper_ids": [ "39922517" ], "n_evidence": 1, "mention_count": 0, "sources": [ "extract" ], "in_model": false, "uncertain": false, "structure": { "accession": "P45983", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/P45983", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-P45983-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-P45983-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/P45983", "mean_plddt": 82.4, "plddt_band": "Confident (70–90)", "n_residues": 427, "local_pdb": "digital_twin\\data\\structures\\P45983_AF.pdb" }, "uniprot": "P45983", "uniprot_name": "Mitogen-activated protein kinase 8", "length": 427, "function": "Serine/threonine-protein kinase involved in various processes such as cell proliferation, differentiation, migration, transformation and programmed cell death. Extracellular stimuli such as pro-inflammatory cytokines or physical stress stimulate the stress-activated protein kinase/c-Jun N-terminal kinase (SAP/JNK) signaling pathway (PubMed:28943315). In this cascade, two dual specificity kinases MAP2K4/MKK4 and MAP2K7/MKK7 phosphorylate and activate MAPK8/JNK1. In turn, MAPK8/JNK1 phosphorylates a number of transcription factors, primarily components of AP-1 such as JUN, JDP2 and ATF2 and thus", "pdb_count": 39, "pdb_ids": [ "1UKH", "1UKI", "2G01", "2GMX", "2H96", "2NO3", "2XRW", "2XS0" ], "grounding": [], "grounded_in_corpus": false }, { "gene": "MICA", "name": "MHC class I polypeptide-related sequence A", "diseases": [ "AA" ], "pathway": "Other", "twin_node": "—", "effect": "?", "role": "driver", "drugs": [], "mechanism": "MICA/B overexpressed on AA hair follicles acts as an NKG2D ligand that activates cytotoxic CD8+/NKG2D+ T cells, contributing to immune privilege collapse.", "evidence_paper_ids": [ "41579939" ], "n_evidence": 1, "mention_count": 0, "sources": [ "discover:AA", "extract" ], "in_model": false, "uncertain": false, "structure": { "accession": "Q29983", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/Q29983", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-Q29983-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-Q29983-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/Q29983", "mean_plddt": 81.7, "plddt_band": "Confident (70–90)", "n_residues": 383, "local_pdb": "digital_twin\\data\\structures\\Q29983_AF.pdb" }, "uniprot": "Q29983", "uniprot_name": "MHC class I polypeptide-related sequence A", "length": 383, "function": "Widely expressed membrane-bound protein which acts as a ligand to stimulate an activating receptor KLRK1/NKG2D, expressed on the surface of essentially all human natural killer (NK), gammadelta T and CD8 alphabeta T-cells (PubMed:11491531, PubMed:11777960). Up-regulated in stressed conditions, such as viral and bacterial infections or DNA damage response, serves as signal of cellular stress, and engagement of KLRK1/NKG2D by MICA triggers NK-cells resulting in a range of immune effector functions, such as cytotoxicity and cytokine production (PubMed:10426993)", "pdb_count": 10, "pdb_ids": [ "1B3J", "1HYR", "7FI5", "7FI6", "7FI7", "7FI8", "7FI9", "8TLZ" ], "grounding": [ { "paper": "ISEV2025 Abstract Book.", "quote": "etworking Research Center in Biomaterials, Bioengineering and Nanomedicine (CIBERBBN), Spain; 4Department of Chemical and Environmental Engineering, U. Zaragoza, Spain; 5SCT Proteómica, Instituto Aragonés de Ciencias de la Salud (IACS), Spain Introduction: Extracellular vesicles (EVs) have the abili", "n_hits": 27 }, { "paper": "Heat treatment increases the incidence of alopecia areata in the C3H HeJ mouse model", "quote": "tions AA Alopecia areata DC Dendritic cell DEBR Dundee experimental bald rats HPA Hypothalamic–pituitary–adrenal HSP Heat shock protein HSPA HSP70 HSPA1A/B Inducible HSP70, HSP70i MICA Major histocompatibility complex class I chain-related A NK Natural killer Introduction With a lifetime risk estima", "n_hits": 13 }, { "paper": "Modulating immune responses in alopecia therapeutic insights and potential targets of antisense oligonucleotides", "quote": "t cells that represent a relevant model for studying the immune mechanisms underlying AA. Specifically, the regulation of proinflammatory chemokines (CXCL9, CXCL10, CXCL11, and MICA) and immune-related markers following treatment with TAMI- M. ORS cells were treated with either TAMI-M (100 nM) or po", "n_hits": 4 }, { "paper": "Alopecia areata susceptibility variant in MHC region impacts expressions of genes contributing to hair keratinization and is involved in hair loss", "quote": "GeneMapper Software (Thermo Fisher Scientific) and conducted as previously described [18]. Fragment sizes were assigned to allele names in the corresponding microsatellites. In the MICA locus, 5 MICA polymorphisms (A4, A5, A5.1, A6, A9) were determined based on the number of alanine (GCT) repeats. Th", "n_hits": 3 } ], "grounded_in_corpus": true }, { "gene": "MICB", "name": "MHC class I polypeptide-related sequence B", "diseases": [ "AA" ], "pathway": "Other", "twin_node": "—", "effect": "?", "role": "driver", "drugs": [], "mechanism": "MICA/B overexpression on hair follicles engages NKG2D on cytotoxic T cells, promoting follicular attack in AA.", "evidence_paper_ids": [ "41579939" ], "n_evidence": 1, "mention_count": 0, "sources": [ "extract" ], "in_model": false, "uncertain": false, "structure": { "accession": "Q29980", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/Q29980", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-Q29980-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-Q29980-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/Q29980", "mean_plddt": 78.0, "plddt_band": "Confident (70–90)", "n_residues": 383, "local_pdb": "digital_twin\\data\\structures\\Q29980_AF.pdb" }, "uniprot": "Q29980", "uniprot_name": "MHC class I polypeptide-related sequence B", "length": 383, "function": "Widely expressed membrane-bound protein which acts as a ligand to stimulate an activating receptor KLRK1/NKG2D, expressed on the surface of essentially all human natural killer (NK), gammadelta T and CD8+ alphabeta T-cells (PubMed:11491531, PubMed:11777960). Up-regulated in stressed conditions, such as viral and bacterial infections or DNA damage response, serves as signal of cellular stress, and engagement of KLRK1/NKG2D by MICA triggers NK-cells resulting in a range of immune effector functions, such as cytotoxicity and cytokine production", "pdb_count": 2, "pdb_ids": [ "1JE6", "2WY3" ], "grounding": [], "grounded_in_corpus": false }, { "gene": "MKI67", "name": "Marker of proliferation Ki-67", "diseases": [ "AGA", "CIA" ], "pathway": "Cell-cycle/apoptosis", "twin_node": "APO", "effect": "?", "role": "protector", "drugs": [], "mechanism": "Cellular proliferation marker; increased Ki-67 staining indicates enhanced dermal papilla cell proliferation after teicoplanin treatment.", "evidence_paper_ids": [ "40672523", "41192849", "41247552", "41371370", "41587585", "41615374", "41662901" ], "n_evidence": 7, "mention_count": 0, "sources": [ "extract" ], "in_model": false, "uncertain": true, "structure": { "accession": "P46013", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/P46013", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-P46013-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-P46013-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/P46013" }, "uniprot": "P46013", "uniprot_name": "Proliferation marker protein Ki-67", "length": 3256, "function": "Protein that associates with the surface of mitotic chromosomes and acts both as a chromosome repellent during early mitosis and chromosome attractant during late mitosis (PubMed:27362226, PubMed:32879492, PubMed:35513709, PubMed:39153474). Required to maintain individual mitotic chromosomes dispersed in the cytoplasm following nuclear envelope disassembly (PubMed:27362226). During early mitosis, relocalizes from nucleoli to the chromosome surface where it forms extended brush structures that cover a substantial fraction of the chromosome surface (PubMed:27362226). The MKI67 brush structure pr", "pdb_count": 3, "pdb_ids": [ "1R21", "2AFF", "5J28" ], "grounding": [ { "paper": "Minoxidil delivered via a stem cell membrane delivery controlled release system promotes hair growth in C57BL6J mice", "quote": "or-1 (IGF-1) were detected by real-time polymerase chain reaction and enzyme-linked immunosorbent assays, respectively. Protein expression levels of marker of proliferation Ki-67 (MKI67) and β-catenin (CTNNB) in skin tissue were detected by immunohistochemistry. Results: STCM-MXD-NPs improved MXD so", "n_hits": 15 }, { "paper": "JAK-STAT1 as therapeutic target for EGFR deficiency-associated inflammation and scarring alopecia", "quote": "Molecular Medicine Volume 16 | December 2024 | 3142 – 3168 © The Author(s) was the downregulated Bmp6, implicated in HF quiescence and the upregulated proliferation-induced gene Mki67 (Fig. EV2D). These data prompted us to specifically look at proliferation, HFSC activation and quiescence genes, whic", "n_hits": 3 } ], "grounded_in_corpus": true }, { "gene": "MYLK", "name": "Myosin light chain kinase (MLCK)", "diseases": [ "AGA" ], "pathway": "HFSC niche", "twin_node": "—", "effect": "?", "role": "driver", "drugs": [], "mechanism": "Drives connective tissue sheath contraction; its inhibition by ML-7 relaxes the peri-follicular sheath and improves hair follicle growth in AGA models.", "evidence_paper_ids": [ "41748637" ], "n_evidence": 1, "mention_count": 0, "sources": [ "extract" ], "in_model": false, "uncertain": true, "structure": { "accession": "Q15746", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/Q15746", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-Q15746-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-Q15746-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/Q15746", "mean_plddt": 65.8, "plddt_band": "Low (50–70)", "n_residues": 1914, "local_pdb": "digital_twin\\data\\structures\\Q15746_AF.pdb" }, "uniprot": "Q15746", "uniprot_name": "Myosin light chain kinase, smooth muscle", "length": 1914, "function": "Calcium/calmodulin-dependent myosin light chain kinase implicated in smooth muscle contraction via phosphorylation of myosin light chains (MLC). Also regulates actin-myosin interaction through a non-kinase activity. Phosphorylates PTK2B/PYK2 and myosin light-chains. Involved in the inflammatory response (e.g. apoptosis, vascular permeability, leukocyte diapedesis), cell motility and morphology, airway hyperreactivity and other activities relevant to asthma. Required for tonic airway smooth muscle contraction that is necessary for physiological and asthmatic airway resistance. Necessary for gas", "pdb_count": 6, "pdb_ids": [ "2CQV", "2K0F", "2YR3", "5JQA", "5JTH", "6C6M" ], "grounding": [], "grounded_in_corpus": false }, { "gene": "NCF2", "name": "Neutrophil cytosolic factor 2 (p67phox)", "diseases": [ "CIA" ], "pathway": "Oxidative stress", "twin_node": "APO", "effect": "+", "role": "driver", "drugs": [], "mechanism": "NCF2, a NADPH oxidase regulatory subunit, mediates S100A8-induced ROS production and ferroptosis in hair follicle keratinocytes during CIA.", "evidence_paper_ids": [ "39947495" ], "n_evidence": 1, "mention_count": 0, "sources": [ "extract" ], "in_model": false, "uncertain": false, "structure": { "accession": "P19878", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/P19878", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-P19878-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-P19878-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/P19878", "mean_plddt": 78.5, "plddt_band": "Confident (70–90)", "n_residues": 526, "local_pdb": "digital_twin\\data\\structures\\P19878_AF.pdb" }, "uniprot": "P19878", "uniprot_name": "Neutrophil cytosol factor 2", "length": 526, "function": "Subunit of the phagocyte NADPH oxidase complex that mediates the transfer of electrons from cytosolic NADPH to O2 to produce the superoxide anion (O2(-)) (PubMed:12207919, PubMed:38355798). In the activated complex, electrons are first transferred from NADPH to flavin adenine dinucleotide (FAD) and subsequently transferred via two heme molecules to molecular oxygen, producing superoxide through an outer-sphere reaction (PubMed:38355798). Activation of the NADPH oxidase complex is initiated by the assembly of cytosolic subunits of the NADPH oxidase complex with the core NADPH oxidase complex to", "pdb_count": 7, "pdb_ids": [ "1E96", "1HH8", "1K4U", "1OEY", "1WM5", "2DMO", "8WEJ" ], "grounding": [], "grounded_in_corpus": false }, { "gene": "NFKBIZ", "name": "NF-kappa-B inhibitor zeta", "diseases": [ "AGA" ], "pathway": "Inflammasome", "twin_node": "INF", "effect": "+", "role": "driver", "drugs": [], "mechanism": "Regulator of inflammatory response in hair follicles; siRNA knockdown alleviates oxidative stress and inflammation in the follicular niche to promote regrowth.", "evidence_paper_ids": [ "41532459" ], "n_evidence": 1, "mention_count": 0, "sources": [ "extract" ], "in_model": false, "uncertain": false, "structure": { "accession": "Q9BYH8", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/Q9BYH8", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-Q9BYH8-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-Q9BYH8-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/Q9BYH8", "mean_plddt": 57.7, "plddt_band": "Low (50–70)", "n_residues": 718, "local_pdb": "digital_twin\\data\\structures\\Q9BYH8_AF.pdb" }, "uniprot": "Q9BYH8", "uniprot_name": "NF-kappa-B inhibitor zeta", "length": 718, "function": "Involved in regulation of NF-kappa-B transcription factor complexes (PubMed:16513645, PubMed:16622025). Inhibits NF-kappa-B activity without affecting its nuclear translocation upon stimulation (PubMed:16513645). Inhibits DNA-binding of RELA and NFKB1/p50, and of the NF-kappa-B p65-p50 heterodimer and the NF-kappa-B p50-p50 homodimer (PubMed:16513645). Also seems to activate NF-kappa-B-mediated transcription (PubMed:16622025). In vitro, upon association with NFKB1/p50 has transcriptional activation activity and, together with NFKB1/p50 and RELA, is recruited to LCN2 promoters (PubMed:16622025)", "pdb_count": 1, "pdb_ids": [ "9BOR" ], "grounding": [], "grounded_in_corpus": false }, { "gene": "NT5E", "name": "5'-nucleotidase ecto (CD73)", "diseases": [ "AA", "AGA" ], "pathway": "Other", "twin_node": "—", "effect": "?", "role": "modulator", "drugs": [], "mechanism": "Tier-2 multi-omics AGA target involved in extracellular adenosine/purine metabolism relevant to follicle regulation.", "evidence_paper_ids": [ "41285252", "41579939" ], "n_evidence": 2, "mention_count": 0, "sources": [ "extract" ], "in_model": false, "uncertain": false, "structure": { "accession": "P21589", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/P21589", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-P21589-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-P21589-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/P21589", "mean_plddt": 91.9, "plddt_band": "Very high (≥90)", "n_residues": 574, "local_pdb": "digital_twin\\data\\structures\\P21589_AF.pdb" }, "uniprot": "P21589", "uniprot_name": "5'-nucleotidase", "length": 574, "function": "Catalyzes the hydrolysis of nucleotide monophosphates, releasing inorganic phosphate and the corresponding nucleoside, with AMP being the preferred substrate (PubMed:21933152, PubMed:22997138, PubMed:23142347, PubMed:24887587, PubMed:34403084). Shows a preference for ribonucleotide monophosphates over their equivalent deoxyribose forms (PubMed:34403084). Other substrates include IMP, UMP, GMP, CMP, dAMP, dCMP, dTMP, NAD and NMN (PubMed:21933152, PubMed:22997138, PubMed:23142347, PubMed:24887587, PubMed:34403084)", "pdb_count": 44, "pdb_ids": [ "4H1S", "4H1Y", "4H2B", "4H2F", "4H2G", "4H2I", "6HXW", "6S7F" ], "grounding": [], "grounded_in_corpus": false }, { "gene": "PAM", "name": "Peptidylglycine alpha-amidating monooxygenase", "diseases": [ "AGA" ], "pathway": "Other", "twin_node": "—", "effect": "?", "role": "modulator", "drugs": [], "mechanism": "Tier-3 multi-omics AGA candidate target; peptide-amidating enzyme prioritized through eQTL/colocalization analysis.", "evidence_paper_ids": [ "41285252" ], "n_evidence": 1, "mention_count": 0, "sources": [ "extract" ], "in_model": false, "uncertain": false, "structure": { "accession": "P19021", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/P19021", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-P19021-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-P19021-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/P19021", "mean_plddt": 71.7, "plddt_band": "Confident (70–90)", "n_residues": 973, "local_pdb": "digital_twin\\data\\structures\\P19021_AF.pdb" }, "uniprot": "P19021", "uniprot_name": "Peptidyl-glycine alpha-amidating monooxygenase", "length": 973, "function": "Bifunctional enzyme that catalyzes amidation of the C-terminus of proteins (PubMed:12699694, PubMed:2357221). Alpha-amidation is present at the C-terminus of many endocrine hormones and neuropeptides and is required for their activity (PubMed:1575450). C-terminal amidation also takes place in response to protein fragmentation triggered by oxidative stress, promoting degradation of amidated protein fragments by the proteasome (PubMed:2207077). Alpha-amidation involves two sequential reactions, both of which are catalyzed by separate catalytic domains of the enzyme (PubMed:12699694). The first s", "pdb_count": 0, "pdb_ids": [], "grounding": [], "grounded_in_corpus": false }, { "gene": "PECAM1", "name": "Platelet endothelial cell adhesion molecule (CD31)", "diseases": [ "AGA", "CIA" ], "pathway": "Growth factor", "twin_node": "DP", "effect": "+", "role": "protector", "drugs": [], "mechanism": "Endothelial marker upregulated with treatment, reflecting enhanced peri-follicular angiogenesis supporting hair growth in AGA.", "evidence_paper_ids": [ "39922517", "41247552" ], "n_evidence": 2, "mention_count": 0, "sources": [ "extract" ], "in_model": false, "uncertain": false, "structure": { "accession": "P16284", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/P16284", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-P16284-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-P16284-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/P16284", "mean_plddt": 80.4, "plddt_band": "Confident (70–90)", "n_residues": 738, "local_pdb": "digital_twin\\data\\structures\\P16284_AF.pdb" }, "uniprot": "P16284", "uniprot_name": "Platelet endothelial cell adhesion molecule", "length": 738, "function": "Cell adhesion molecule which is required for leukocyte transendothelial migration (TEM) under most inflammatory conditions (PubMed:17580308, PubMed:19342684). Tyr-690 plays a critical role in TEM and is required for efficient trafficking of PECAM1 to and from the lateral border recycling compartment (LBRC) and is also essential for the LBRC membrane to be targeted around migrating leukocytes (PubMed:19342684). Trans-homophilic interaction may play a role in endothelial cell-cell adhesion via cell junctions (PubMed:27958302). Heterophilic interaction with CD177 plays a role in transendothelial ", "pdb_count": 3, "pdb_ids": [ "2KY5", "5C14", "5GNI" ], "grounding": [], "grounded_in_corpus": false }, { "gene": "PIEZO1", "name": "Piezo-type mechanosensitive ion channel component 1", "diseases": [ "AGA" ], "pathway": "HFSC niche", "twin_node": "APO", "effect": "+", "role": "driver", "drugs": [], "mechanism": "Mechanosensitive channel activated by hypercontractile connective tissue sheath, inducing ectopic apoptosis of progenitor cells and suppressing matrix/ORS proliferation, driving follicle miniaturization.", "evidence_paper_ids": [ "41748637" ], "n_evidence": 1, "mention_count": 0, "sources": [ "extract" ], "in_model": false, "uncertain": false, "structure": { "accession": "Q92508", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/Q92508", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-Q92508-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-Q92508-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/Q92508", "mean_plddt": 72.0, "plddt_band": "Confident (70–90)", "n_residues": 2521, "local_pdb": "digital_twin\\data\\structures\\Q92508_AF.pdb" }, "uniprot": "Q92508", "uniprot_name": "Piezo-type mechanosensitive ion channel component 1", "length": 2521, "function": "Pore-forming subunit of the mechanosensitive non-specific cation Piezo channel required for rapidly adapting mechanically activated (MA) currents and has a key role in sensing touch and tactile pain (PubMed:23479567, PubMed:23695678, PubMed:25955826, PubMed:37590348). Piezo channels are homotrimeric three-blade propeller-shaped structures that utilize a cap-motion and plug-and-latch mechanism to gate their ion-conducting pathways (PubMed:37590348). Generates currents characterized by a linear current-voltage relationship that are sensitive to ruthenium red and gadolinium (By similarity). Condu", "pdb_count": 6, "pdb_ids": [ "8YEZ", "8YFC", "8YFG", "8ZU3", "8ZU8", "9VMX" ], "grounding": [ { "paper": "Causes and therapeutic limitations of clinical alopecia and the advent of human pluripotent stem cell follicular transplantation", "quote": "teraction. They found that the native contraction force of dermal cells provides a stretching force to the corresponding epidermal cells, activating the stretching force sensor Piezo1. Subsequently, epidermal Piezo1 triggers the initial mesenchymal-epithelial inter­ action (MEI). Undoubtedly, this m", "n_hits": 2 } ], "grounded_in_corpus": true }, { "gene": "POSTN", "name": "Periostin", "diseases": [ "AA" ], "pathway": "BMP/TGFβ", "twin_node": "INF", "effect": "?", "role": "driver", "drugs": [], "mechanism": "Periostin is enriched in lesional AA fibroblasts as a pro-fibrotic/TGFβ-associated matrix marker reflecting stromal remodeling in disease.", "evidence_paper_ids": [ "41740930" ], "n_evidence": 1, "mention_count": 0, "sources": [ "extract" ], "in_model": false, "uncertain": false, "structure": { "accession": "Q15063", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/Q15063", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-Q15063-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-Q15063-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/Q15063", "mean_plddt": 80.4, "plddt_band": "Confident (70–90)", "n_residues": 836, "local_pdb": "digital_twin\\data\\structures\\Q15063_AF.pdb" }, "uniprot": "Q15063", "uniprot_name": "Periostin", "length": 836, "function": "Induces cell attachment and spreading and plays a role in cell adhesion (PubMed:12235007). Enhances incorporation of BMP1 in the fibronectin matrix of connective tissues, and subsequent proteolytic activation of lysyl oxidase LOX (By similarity)", "pdb_count": 3, "pdb_ids": [ "5WT7", "5YJG", "5YJH" ], "grounding": [ { "paper": "Deletion of hypoxia-inducible factor prolyl 4-hydroxylase 2 in FoxD1-lineage mesenchymal cells leads to congenital truncal alopecia", "quote": "β1 was typically upregulated (Fig. 7A) in most of the time points, whereas TGFβ2 was downregulated and TGFβ3 was mostly unchanged (Fig. S5, A and B). Since, especially, periostin (Postn) and plasminogen activator inhibitor 1 (Pai1), target genes of TGFβ signaling, showed significant and parallel chan", "n_hits": 3 }, { "paper": "ISEV2025 Abstract Book.", "quote": "icantly alter the viability and metabolic potential of HCM CFs. However, molecular char- acterisation suggested a significant reduction in mRNA levels of activation markers ACTA2, POSTN, FAP, COL1A1, IL-6 and IL-11 (p < 0.0001) following treatment. A significant reduction in α- SMA positive cells (p", "n_hits": 2 } ], "grounded_in_corpus": true }, { "gene": "PPARGC1A", "name": "Peroxisome proliferator-activated receptor gamma coactivator 1-alpha", "diseases": [ "AGA" ], "pathway": "Other", "twin_node": "—", "effect": "?", "role": "modulator", "drugs": [ "Bezafibrate", "Metformin (indirect)" ], "mechanism": "Metabolic/mitochondrial biogenesis coactivator identified as an emerging AGA target linking cellular metabolism to follicle health.", "evidence_paper_ids": [ "41769701" ], "n_evidence": 1, "mention_count": 0, "sources": [ "discover:HFSC", "extract" ], "in_model": false, "uncertain": false, "structure": { "accession": "Q9UBK2", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/Q9UBK2", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-Q9UBK2-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-Q9UBK2-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/Q9UBK2", "mean_plddt": 52.7, "plddt_band": "Low (50–70)", "n_residues": 798, "local_pdb": "digital_twin\\data\\structures\\Q9UBK2_AF.pdb" }, "uniprot": "Q9UBK2", "uniprot_name": "Peroxisome proliferator-activated receptor gamma coactivator 1-alpha", "length": 798, "function": "Transcriptional coactivator for steroid receptors and nuclear receptors (PubMed:10713165, PubMed:20005308, PubMed:21376232, PubMed:28363985, PubMed:32433991). Greatly increases the transcriptional activity of PPARG and thyroid hormone receptor on the uncoupling protein promoter (PubMed:10713165, PubMed:20005308, PubMed:21376232). Can regulate key mitochondrial genes that contribute to the program of adaptive thermogenesis (PubMed:10713165, PubMed:20005308, PubMed:21376232). Plays an essential role in metabolic reprogramming in response to dietary availability through coordination of the expres", "pdb_count": 37, "pdb_ids": [ "1XB7", "3B1M", "3CS8", "3D24", "3U9Q", "3V9T", "3V9V", "4QJR" ], "grounding": [ { "paper": "Use of genetics in the prediction of success in male pattern hair loss therapy and mechanistic studies.", "quote": "lished therapies such as topical and oral minoxidil, finasteride, dutasteride, and prostaglandin-directed approaches. We also discuss emerging targets, including IGF1R, WNT10A, PPARGC1A, and prolactin receptor signalling, and examine how RNA based androgen receptor silencing and stem-cell-derived re", "n_hits": 3 } ], "grounded_in_corpus": true }, { "gene": "PRLR", "name": "Prolactin receptor", "diseases": [ "AGA" ], "pathway": "Nuclear receptor", "twin_node": "HFSC", "effect": "?", "role": "modulator", "drugs": [], "mechanism": "Prolactin receptor signaling implicated as an AGA susceptibility/therapeutic target and prioritized in multi-omics target ranking.", "evidence_paper_ids": [ "41285252", "41769701" ], "n_evidence": 2, "mention_count": 0, "sources": [ "extract" ], "in_model": false, "uncertain": false, "structure": { "accession": "P16471", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/P16471", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-P16471-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-P16471-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/P16471", "mean_plddt": 61.0, "plddt_band": "Low (50–70)", "n_residues": 622, "local_pdb": "digital_twin\\data\\structures\\P16471_AF.pdb" }, "uniprot": "P16471", "uniprot_name": "Prolactin receptor", "length": 622, "function": "This is a receptor for the anterior pituitary hormone prolactin (PRL). Acts as a prosurvival factor for spermatozoa by inhibiting sperm capacitation through suppression of SRC kinase activation and stimulation of AKT. Isoform 4 is unable to transduce prolactin signaling. Isoform 6 is unable to transduce prolactin signaling", "pdb_count": 12, "pdb_ids": [ "1BP3", "2LFG", "2N7I", "3D48", "3MZG", "3N06", "3N0P", "3NCB" ], "grounding": [ { "paper": "Use of genetics in the prediction of success in male pattern hair loss therapy and mechanistic studies.", "quote": "dling, providing a metabolic framework that may interact with treatment response in miniaturised follicles (Geyfman et al., 2012; Li et al., 2012). Finally, prolactin receptor (PRLR) signalling has emerged as a compelling candidate: prolactin and PRLR modulate human follicular cycling, with excess p", "n_hits": 9 } ], "grounded_in_corpus": true }, { "gene": "S100A8", "name": "S100 calcium binding protein A8", "diseases": [ "CIA" ], "pathway": "Oxidative stress", "twin_node": "APO", "effect": "+", "role": "driver", "drugs": [], "mechanism": "S100A8 is upregulated by cyclophosphamide and drives hair follicle ferroptosis via the NCF2/NOX2 axis, promoting chemotherapy-induced alopecia.", "evidence_paper_ids": [ "39947495" ], "n_evidence": 1, "mention_count": 0, "sources": [ "extract" ], "in_model": false, "uncertain": false, "structure": { "accession": "P05109", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/P05109", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-P05109-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-P05109-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/P05109", "mean_plddt": 93.0, "plddt_band": "Very high (≥90)", "n_residues": 93, "local_pdb": "digital_twin\\data\\structures\\P05109_AF.pdb" }, "uniprot": "P05109", "uniprot_name": "Protein S100-A8", "length": 93, "function": "S100A8 is a calcium- and zinc-binding protein which plays a prominent role in the regulation of inflammatory processes and immune response. It can induce neutrophil chemotaxis and adhesion. Predominantly found as calprotectin (S100A8/A9) which has a wide plethora of intra- and extracellular functions. The intracellular functions include: facilitating leukocyte arachidonic acid trafficking and metabolism, modulation of the tubulin-dependent cytoskeleton during migration of phagocytes and activation of the neutrophilic NADPH-oxidase. Also participates in regulatory T-cell differentiation togethe", "pdb_count": 11, "pdb_ids": [ "1MR8", "1XK4", "4GGF", "4XJK", "5HLO", "5HLV", "5W1F", "6DS2" ], "grounding": [ { "paper": "Genetic analysis of a novel antioxidant multi-target iron chelator, M30 protecting against chemotherapy-induced alopecia in mice", "quote": "Condition 1* CTX/ Normal MC/ CTX Condition 1 CTX/ Normal MC/ CTX Condition 1 CTX/ Normal MC/ CTX Condition 1 CTX/ Normal MC/ CTX Shh 11.540 0.384 Gjb6 9.359 0.258 Shh 11.540 0.384 S100a8 11.647 0.555 Lef1 9.036 0.201 Krt25 5.496 0.139 Oca2 11.515 0.072 Shh 11.540 0.384 Adm2 7.801 0.213 Alox12 4.174 ", "n_hits": 5 } ], "grounded_in_corpus": true }, { "gene": "SOD1", "name": "Superoxide dismutase [Cu-Zn]", "diseases": [ "AGA", "CIA" ], "pathway": "Oxidative stress", "twin_node": "APO", "effect": "-", "role": "protector", "drugs": [], "mechanism": "Tier-1 multi-omics AGA target; antioxidant enzyme protecting follicle cells from reactive-oxygen-species-mediated damage.", "evidence_paper_ids": [ "41285252", "41615374" ], "n_evidence": 2, "mention_count": 0, "sources": [ "extract" ], "in_model": false, "uncertain": false, "structure": { "accession": "P00441", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/P00441", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-P00441-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-P00441-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/P00441", "mean_plddt": 97.9, "plddt_band": "Very high (≥90)", "n_residues": 154, "local_pdb": "digital_twin\\data\\structures\\P00441_AF.pdb" }, "uniprot": "P00441", "uniprot_name": "Superoxide dismutase [Cu-Zn]", "length": 154, "function": "Destroys radicals which are normally produced within the cells and which are toxic to biological systems (PubMed:24140062). Catalyzes the oxidation of hydrogen sulfide (H2S) to sulfate, playing an important role in detoxifying H2S and limiting the accumulation of reactive sulfur species (RSS) such as persulfides and polysulfides (PubMed:36630448)", "pdb_count": 151, "pdb_ids": [ "1AZV", "1BA9", "1DSW", "1FUN", "1HL4", "1HL5", "1KMG", "1L3N" ], "grounding": [ { "paper": "ISEV2025 Abstract Book.", "quote": "different proteins have been linked to ALS, leading to controversy over whether ALS is one disease or many diseases with a similar phenotype. Mutations in Superoxide Dismutase 1 (SOD1) are only found in 2%–3% of amyotrophic lateral sclerosis (ALS) cases, yet misfolded SOD1 is found in both sporadic ", "n_hits": 12 }, { "paper": "Extracellular vesicles in age-related diseases disease pathogenesis, intervention, and biomarker.", "quote": "mponents. EVs derived from AD sam- ple shows signs of mitochondrial abnormalities, including lower levels of complexes I, III, IV, and V of ATP synthase, superoxide dismutase 1 (SOD1), and catalytic activity of complex IV, indicating abnormalities in electron trans- port chain (ETC) that may leads i", "n_hits": 2 }, { "paper": "Promotion of Hair Regrowth in Androgenetic Alopecia with Supplemented Erzhi Wan Exploring Its Mechanism Using Network Pharmacology and Molecular Docking", "quote": "etin POR Mohanlian MOL000098 Quercetin ODC1 Mohanlian MOL000098 Quercetin CASP8 Mohanlian MOL000098 Quercetin TOP1 Mohanlian MOL000098 Quercetin RAF1 Mohanlian MOL000098 Quercetin SOD1 Mohanlian MOL000098 Quercetin PRKCA Mohanlian MOL000098 Quercetin MMP1 Mohanlian MOL000098 Quercetin HIF1A Mohanlia", "n_hits": 2 } ], "grounded_in_corpus": true }, { "gene": "SQLE", "name": "Squalene monooxygenase", "diseases": [ "AGA" ], "pathway": "Other", "twin_node": "—", "effect": "?", "role": "modulator", "drugs": [], "mechanism": "Tier-2 multi-omics AGA target; rate-limiting cholesterol/sterol biosynthesis enzyme linked to follicular lipid metabolism.", "evidence_paper_ids": [ "41285252" ], "n_evidence": 1, "mention_count": 0, "sources": [ "extract" ], "in_model": false, "uncertain": false, "structure": { "accession": "Q14534", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/Q14534", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-Q14534-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-Q14534-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/Q14534", "mean_plddt": 85.8, "plddt_band": "Confident (70–90)", "n_residues": 574, "local_pdb": "digital_twin\\data\\structures\\Q14534_AF.pdb" }, "uniprot": "Q14534", "uniprot_name": "Squalene monooxygenase", "length": 574, "function": "Catalyzes the stereospecific oxidation of squalene to (S)-2,3-epoxysqualene, and is considered to be a rate-limiting enzyme in steroid biosynthesis", "pdb_count": 3, "pdb_ids": [ "6C6N", "6C6P", "6C6R" ], "grounding": [], "grounded_in_corpus": false }, { "gene": "SREBF1", "name": "Sterol regulatory element-binding protein 1 (SREBP-1)", "diseases": [ "AGA" ], "pathway": "Other", "twin_node": "—", "effect": "?", "role": "driver", "drugs": [], "mechanism": "Master regulator of lipid metabolism; SREBP-1-mediated lipid metabolism is suppressed by Xiaozhi Yufa decoction to improve AGA with metabolic dysfunction.", "evidence_paper_ids": [ "41394121" ], "n_evidence": 1, "mention_count": 0, "sources": [ "extract" ], "in_model": false, "uncertain": false, "structure": { "accession": "P36956", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/P36956", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-P36956-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-P36956-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/P36956", "mean_plddt": 63.5, "plddt_band": "Low (50–70)", "n_residues": 1147, "local_pdb": "digital_twin\\data\\structures\\P36956_AF.pdb" }, "uniprot": "P36956", "uniprot_name": "Sterol regulatory element-binding protein 1", "length": 1147, "function": "Precursor of the transcription factor form (Processed sterol regulatory element-binding protein 1), which is embedded in the endoplasmic reticulum membrane (PubMed:32322062). Low sterol concentrations promote processing of this form, releasing the transcription factor form that translocates into the nucleus and activates transcription of genes involved in cholesterol biosynthesis and lipid homeostasis (By similarity)", "pdb_count": 1, "pdb_ids": [ "1AM9" ], "grounding": [], "grounded_in_corpus": false }, { "gene": "TAC1", "name": "Tachykinin precursor 1 (substance P)", "diseases": [ "AA", "AGA", "CIA", "Scarring", "TelogenEffluvium" ], "pathway": "Other", "twin_node": "—", "effect": "?", "role": "driver", "drugs": [ "aprepitant / NK1R antagonists (concept)" ], "mechanism": "Substance P contributes to trichodynia and perifollicular neurogenic inflammation associated with multiple alopecia types including chemotherapy-induced alopecia.", "evidence_paper_ids": [ "40691934" ], "n_evidence": 1, "mention_count": 0, "sources": [ "discover:recent", "extract" ], "in_model": false, "uncertain": false, "structure": { "accession": "P20366", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/P20366", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-P20366-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-P20366-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/P20366", "mean_plddt": 66.9, "plddt_band": "Low (50–70)", "n_residues": 129, "local_pdb": "digital_twin\\data\\structures\\P20366_AF.pdb" }, "uniprot": "P20366", "uniprot_name": "Protachykinin-1", "length": 129, "function": "Tachykinins are active peptides which excite neurons, evoke behavioral responses, are potent vasodilators and secretagogues, and contract (directly or indirectly) many smooth muscles", "pdb_count": 13, "pdb_ids": [ "2B19", "2KS9", "2KSA", "2KSB", "4HOM", "7P00", "7P02", "7RMG" ], "grounding": [], "grounded_in_corpus": false }, { "gene": "TEC", "name": "Tyrosine kinase expressed in hepatocellular carcinoma", "diseases": [ "AA" ], "pathway": "JAK-STAT", "twin_node": "INF", "effect": "+", "role": "driver", "drugs": [], "mechanism": "TEC-family kinase signaling contributes to T-cell-mediated AA; ritlecitinib dual JAK3/TEC inhibition is effective in severe AA.", "evidence_paper_ids": [ "41449716", "41645877" ], "n_evidence": 2, "mention_count": 0, "sources": [ "extract" ], "in_model": false, "uncertain": false, "structure": { "accession": "Q92570", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/Q92570", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-Q92570-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-Q92570-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/Q92570", "mean_plddt": 64.2, "plddt_band": "Low (50–70)", "n_residues": 626, "local_pdb": "digital_twin\\data\\structures\\Q92570_AF.pdb" }, "uniprot": "Q92570", "uniprot_name": "Nuclear receptor subfamily 4 group A member 3", "length": 626, "function": "Transcriptional activator that binds to regulatory elements in promoter regions in a cell- and response element (target)-specific manner. Induces gene expression by binding as monomers to the NR4A1 response element (NBRE) 5'-AAAAGGTCA-3' site and as homodimers to the Nur response element (NurRE) site in the promoter of their regulated target genes (By similarity). Plays a role in the regulation of proliferation, survival and differentiation of many different cell types and also in metabolism and inflammation. Mediates proliferation of vascular smooth muscle, myeloid progenitor cell and type B ", "pdb_count": 1, "pdb_ids": [ "8XTT" ], "grounding": [ { "paper": "ISEV2025 Abstract Book.", "quote": "ired kidney function that occurs in 40%– 60% of systemic lupus erythematosus (SLE) patients. LN is characterized by a marked interferon (IFN) response in tubular epithelial cells (TEC), but the biological trigger has remained unclear. We previously showed that extracellular vesicles (EVs) released b", "n_hits": 15 }, { "paper": "2,5-Diazabicyclo[2.2.1]heptane in medicinal chemistry a treasure trove of therapeutic opportunities.", "quote": "njugated with 2,5-DBH to develop compounds with promising biological activity. Bruton's tyrosine kinase (BTK) is part of the tyrosine kinase expressed in hepatocellular carcinoma (TEC) kinase family and is predominantly found in hematopoietic cells, including B-cells, macrophages, monocytes, and mas", "n_hits": 4 }, { "paper": "Hydrogel forming microneedles loaded with VEGF and Ritlecitinib,polyhydroxyalkanoates nanoparticles for mini-invasive androgenetic alopecia treatment", "quote": "ldman demonstrated that VEGF expression was significantly reduced in alopecic follicles compared to normal human hair follicles [28,29]. Ritlecitinib is an inhibitor of JAK3 and TEC kinases, blocking γ common chain cytokine signaling and inhibiting CD8+ T cells and natural killer cells (these cells ", "n_hits": 2 }, { "paper": "Improvement in Patient-Reported Emotional Symptoms and Activity Limitations due to Hair Loss in Patients With Alopecia Areata Treated With Ritlecitini", "quote": "AK2 inhibitor indicated for adult patients [27, 28], and ritlecitinib is a dual inhibitor of JAK3 and JAK5 members of the tyrosine kinase expressed in hepatocellular carcinoma (TEC) family indicated for adult and adolescent patients [14, 29]. Both baricitinib and ritlecitinib demonstrated clinically", "n_hits": 2 } ], "grounded_in_corpus": true }, { "gene": "TMPRSS2", "name": "Transmembrane protease serine 2", "diseases": [ "AGA" ], "pathway": "Androgen signaling", "twin_node": "AND", "effect": "+", "role": "driver", "drugs": [], "mechanism": "Androgen receptor downstream target gene; downregulated by teicoplanin alongside AR, reflecting reduced androgen signaling activity.", "evidence_paper_ids": [ "41662901" ], "n_evidence": 1, "mention_count": 0, "sources": [ "extract" ], "in_model": false, "uncertain": false, "structure": { "accession": "O15393", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/O15393", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-O15393-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-O15393-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/O15393", "mean_plddt": 79.4, "plddt_band": "Confident (70–90)", "n_residues": 492, "local_pdb": "digital_twin\\data\\structures\\O15393_AF.pdb" }, "uniprot": "O15393", "uniprot_name": "Transmembrane protease serine 2", "length": 492, "function": "Plasma membrane-anchored serine protease that cleaves at arginine residues (PubMed:32703818, PubMed:35676539, PubMed:37990007, PubMed:38964328). Participates in proteolytic cascades of relevance for the normal physiologic function of the prostate (PubMed:25122198). Androgen-induced TMPRSS2 activates several substrates that include pro-hepatocyte growth factor/HGF, the protease activated receptor-2/F2RL1 or matriptase/ST14 leading to extracellular matrix disruption and metastasis of prostate cancer cells (PubMed:15537383, PubMed:25122198, PubMed:26018085). In addition, activates trigeminal neur", "pdb_count": 30, "pdb_ids": [ "7MEQ", "7XYD", "7Y0E", "7Y0F", "8HD8", "8JHZ", "8JI0", "8S0L" ], "grounding": [], "grounded_in_corpus": false }, { "gene": "TNF", "name": "Tumor necrosis factor alpha", "diseases": [ "CIA" ], "pathway": "Other", "twin_node": "—", "effect": "?", "role": "driver", "drugs": [], "mechanism": "Pro-inflammatory cytokine elevated in chemotherapy-damaged skin; its suppression is associated with reduced follicular inflammation and hair-loss mitigation.", "evidence_paper_ids": [ "41615374", "PPR1114305" ], "n_evidence": 2, "mention_count": 0, "sources": [ "extract" ], "in_model": false, "uncertain": false, "structure": { "accession": "P01375", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/P01375", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-P01375-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-P01375-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/P01375", "mean_plddt": 84.6, "plddt_band": "Confident (70–90)", "n_residues": 233, "local_pdb": "digital_twin\\data\\structures\\P01375_AF.pdb" }, "uniprot": "P01375", "uniprot_name": "Tumor necrosis factor", "length": 233, "function": "Cytokine that binds to TNFRSF1A/TNFR1 and TNFRSF1B/TNFBR. It is mainly secreted by macrophages and can induce cell death of certain tumor cell lines. It is potent pyrogen causing fever by direct action or by stimulation of interleukin-1 secretion and is implicated in the induction of cachexia, Under certain conditions it can stimulate cell proliferation and induce cell differentiation. Impairs regulatory T-cells (Treg) function in individuals with rheumatoid arthritis via FOXP3 dephosphorylation. Up-regulates the expression of protein phosphatase 1 (PP1), which dephosphorylates the key 'Ser-41", "pdb_count": 49, "pdb_ids": [ "1A8M", "1TNF", "2AZ5", "2E7A", "2TUN", "2ZJC", "2ZPX", "3ALQ" ], "grounding": [ { "paper": "ISEV2025 Abstract Book.", "quote": "ride (LPS) and subsequently to ECFC- sEVs. After 24 h, cells were harvested for qPCR analysis of inflammation-associated genes. Furthermore, the conditioned medium was assayed for TNFα and troponin I levels using ELISA. For in vivo experiments, LPS was administered to CDH5/mTmG mice, followed by ECF", "n_hits": 75 }, { "paper": "Extracellular vesicles in age-related diseases disease pathogenesis, intervention, and biomarker.", "quote": "gen degradation. With age, the accumulation of reactive oxygen spe- cies (ROS) activates mitogen-activated protein kinase/ nuclear factor kappa beta (MAPK/NF-kB) pathway through TNF-α stimulation, leading to the production of matrix metalloproteinases (MMPs) [28]. MMPs are a family of zinc-dependent", "n_hits": 16 }, { "paper": "Hair follicle-derived mesenchymal stem cells decrease alopecia areata mouse hair loss and reduce inflammation around the hair follicle", "quote": "ivilege by suppression of autoantigen presentation sys- tem like major histocompatibility complex (MHC) class I [8]. Some proinflammatory cytokines like tumor necrosis factor-α (TNF-α) and interleukin-6 (IL-6) also coordinate cyclical hair growth within the AA pathogenesis [9–11]. Hormone drugs are ", "n_hits": 15 }, { "paper": "Periplaneta americana extract (L.) promotes hair regrowth in Alopecia areata mice by reducing inflammation and modulating skin microbiota", "quote": "k pharmacology showed PA-011 could regulate AA-related targets and pathways. PA-011 intervention promoted hair follicle cell proliferation and hair growth in AA mice, reduced skin TNF-α, IL-23, and VCAM-1 expression. Transcriptomics and WB analysis indicated PA-011 downregulated inflammatory genes, a", "n_hits": 14 } ], "grounded_in_corpus": true }, { "gene": "TNFRSF4", "name": "TNF receptor superfamily member 4 (OX40)", "diseases": [ "AA" ], "pathway": "Other", "twin_node": "—", "effect": "?", "role": "driver", "drugs": [ "amlitelimab (anti-OX40L, repurposing concept)", "anti-OX40 antibodies (InmaGene, investigational)" ], "mechanism": "OX40 (TNFRSF4) is elevated on lesional CD4+ and regulatory T cells in AA, promoting T-cell costimulation and sustained autoimmune inflammation.", "evidence_paper_ids": [ "41740930" ], "n_evidence": 1, "mention_count": 0, "sources": [ "discover:recent", "extract" ], "in_model": false, "uncertain": false, "structure": { "accession": "P43489", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/P43489", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-P43489-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-P43489-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/P43489", "mean_plddt": 77.0, "plddt_band": "Confident (70–90)", "n_residues": 277, "local_pdb": "digital_twin\\data\\structures\\P43489_AF.pdb" }, "uniprot": "P43489", "uniprot_name": "Tumor necrosis factor receptor superfamily member 4", "length": 277, "function": "Receptor for TNFSF4/OX40L/GP34. Is a costimulatory molecule implicated in long-term T-cell immunity", "pdb_count": 8, "pdb_ids": [ "1D0A", "2HEV", "2HEY", "6OGX", "6OKM", "6OKN", "7YK4", "8AG1" ], "grounding": [], "grounded_in_corpus": false }, { "gene": "TYR", "name": "Tyrosinase", "diseases": [ "CIA" ], "pathway": "Other", "twin_node": "—", "effect": "?", "role": "protector", "drugs": [], "mechanism": "Rate-limiting melanogenic enzyme whose induction restores follicular melanocyte function and pigmentation after chemotherapy.", "evidence_paper_ids": [ "41192849" ], "n_evidence": 1, "mention_count": 0, "sources": [ "extract" ], "in_model": false, "uncertain": false, "structure": { "accession": "P14679", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/P14679", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-P14679-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-P14679-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/P14679", "mean_plddt": 89.9, "plddt_band": "Confident (70–90)", "n_residues": 529, "local_pdb": "digital_twin\\data\\structures\\P14679_AF.pdb" }, "uniprot": "P14679", "uniprot_name": "Tyrosinase", "length": 529, "function": "This is a copper-containing oxidase that functions in the formation of pigments such as melanins and other polyphenolic compounds. Catalyzes the initial and rate limiting step in the cascade of reactions leading to melanin production from tyrosine (By similarity). In addition to hydroxylating tyrosine to DOPA (3,4-dihydroxyphenylalanine), also catalyzes the oxidation of DOPA to DOPA-quinone, and possibly the oxidation of DHI (5,6-dihydroxyindole) to indole-5,6 quinone (PubMed:28661582)", "pdb_count": 1, "pdb_ids": [ "7RK7" ], "grounding": [ { "paper": "Polyphenols from Bacopa procumbens Nanostructured with Gold Nanoparticles Stimulate Hair Growth Through Apoptosis Modulation in C57BL 6 Mice", "quote": "s. The bar colors in the graph correspond to the colors of the ligands represented in (a). (c) Two-dimensional diagrams of intermolecular protein–ligand interactions, highlighting Tyr 204 (indicated with red circles) as a key residue for ligand binding. (d) Vi- sualization of specific ligand interac", "n_hits": 4 }, { "paper": "Promotion of Hair Regrowth in Androgenetic Alopecia with Supplemented Erzhi Wan Exploring Its Mechanism Using Network Pharmacology and Molecular Docking", "quote": "eolin ICAM1 Mohanlian MOL000006 Luteolin MCL1 Mohanlian MOL000006 Luteolin BIRC5 Mohanlian MOL000006 Luteolin IL2RA Mohanlian MOL000006 Luteolin CCNB1 Mohanlian MOL000006 Luteolin TYR Mohanlian MOL000006 Luteolin IFNG Mohanlian MOL000006 Luteolin IL4 Mohanlian MOL000006 Luteolin TOP2A Mohanlian MOL0", "n_hits": 2 } ], "grounded_in_corpus": true }, { "gene": "TYRP1", "name": "Tyrosinase-related protein 1", "diseases": [ "CIA" ], "pathway": "Other", "twin_node": "—", "effect": "?", "role": "protector", "drugs": [], "mechanism": "Melanogenic enzyme upregulated to support melanocyte function and hair re-pigmentation in chemotherapy-induced alopecia.", "evidence_paper_ids": [ "41192849" ], "n_evidence": 1, "mention_count": 0, "sources": [ "extract" ], "in_model": false, "uncertain": false, "structure": { "accession": "P17643", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/P17643", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-P17643-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-P17643-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/P17643", "mean_plddt": 91.7, "plddt_band": "Very high (≥90)", "n_residues": 537, "local_pdb": "digital_twin\\data\\structures\\P17643_AF.pdb" }, "uniprot": "P17643", "uniprot_name": "5,6-dihydroxyindole-2-carboxylic acid oxidase", "length": 537, "function": "Plays a role in melanin biosynthesis (PubMed:16704458, PubMed:22556244, PubMed:23504663). Catalyzes the oxidation of 5,6-dihydroxyindole-2-carboxylic acid (DHICA) into indole-5,6-quinone-2-carboxylic acid in the presence of bound Cu(2+) ions, but not in the presence of Zn(2+) (PubMed:28661582). May regulate or influence the type of melanin synthesized (PubMed:16704458, PubMed:22556244). Also to a lower extent, capable of hydroxylating tyrosine and producing melanin (By similarity)", "pdb_count": 13, "pdb_ids": [ "5M8L", "5M8M", "5M8N", "5M8O", "5M8P", "5M8Q", "5M8R", "5M8S" ], "grounding": [], "grounded_in_corpus": false }, { "gene": "WNT10A", "name": "Protein Wnt-10a", "diseases": [ "AGA" ], "pathway": "Wnt/β-catenin", "twin_node": "Wnt", "effect": "+", "role": "protector", "drugs": [], "mechanism": "WNT ligand among GWAS susceptibility loci; activates Wnt signaling required for hair follicle induction and growth.", "evidence_paper_ids": [ "41769701" ], "n_evidence": 1, "mention_count": 0, "sources": [ "extract" ], "in_model": false, "uncertain": false, "structure": { "accession": "Q9GZT5", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/Q9GZT5", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-Q9GZT5-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-Q9GZT5-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/Q9GZT5", "mean_plddt": 81.9, "plddt_band": "Confident (70–90)", "n_residues": 417, "local_pdb": "digital_twin\\data\\structures\\Q9GZT5_AF.pdb" }, "uniprot": "Q9GZT5", "uniprot_name": "Protein Wnt-10a", "length": 417, "function": "Ligand for members of the frizzled family of seven transmembrane receptors (Probable). Functions in the canonical Wnt/beta-catenin signaling pathway (By similarity). Plays a role in normal ectoderm development (PubMed:17847007, PubMed:28589954). Required for normal tooth development (PubMed:17847007, PubMed:28589954, PubMed:29178643). Required for normal postnatal development and maintenance of tongue papillae and sweat ducts (PubMed:28589954). Required for normal proliferation of basal cells in tongue filiform papillae, plantar epithelium and sweat ducts. Required for normal expression of ker", "pdb_count": 0, "pdb_ids": [], "grounding": [ { "paper": "Use of genetics in the prediction of success in male pattern hair loss therapy and mechanistic studies.", "quote": "of established therapies such as topical and oral minoxidil, finasteride, dutasteride, and prostaglandin-directed approaches. We also discuss emerging targets, including IGF1R, WNT10A, PPARGC1A, and prolactin receptor signalling, and examine how RNA based androgen receptor silencing and stem-cell-de", "n_hits": 13 }, { "paper": "The Genetic Landscape of Androgenetic Alopecia Current Knowledge and Future Perspectives.", "quote": "quencing data from the UK Biobank suggests that rare genetic variants play a relatively small role in AGA risk, with associations limited to few (5) genes, two of which (EDA2R and WNT10A) are already implicated by GWAS, rather than evidence for rare, high-impact mutations [20]. 2.2. Key Biological P", "n_hits": 9 }, { "paper": "Modified Huanjingjian Prevents Chemotherapy-Induced Alopecia by Inhibiting Genomic DNA Methylation of the Wnt Signaling Pathway in Mice", "quote": "ions, with gene body methylation constituting 60% of total methylation changes. Methylation- modulated genes predominantly localized to Wnt signaling pathways: MHJJ enhanced Wnt3/Wnt10a expression while suppressing Cer1/Axin1. Corresponding methylation reductions at promoter and gene body regions we", "n_hits": 8 } ], "grounded_in_corpus": true }, { "gene": "XCL1", "name": "X-C motif chemokine ligand 1", "diseases": [ "AA" ], "pathway": "Chemokine", "twin_node": "INF", "effect": "+", "role": "driver", "drugs": [], "mechanism": "XCL1 is upregulated in lesional AA, recruiting cytotoxic/dendritic cells to amplify the follicular immune attack.", "evidence_paper_ids": [ "41740930" ], "n_evidence": 1, "mention_count": 0, "sources": [ "extract" ], "in_model": false, "uncertain": false, "structure": { "accession": "P47992", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/P47992", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-P47992-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-P47992-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/P47992", "mean_plddt": 78.8, "plddt_band": "Confident (70–90)", "n_residues": 114, "local_pdb": "digital_twin\\data\\structures\\P47992_AF.pdb" }, "uniprot": "P47992", "uniprot_name": "Lymphotactin", "length": 114, "function": "Chemotactic activity for lymphocytes but not for monocytes or neutrophils. In thymus, mediates medullary accumulation of thymic dendritic cells and contributes to regulatoy T cell development, playing a role in self-tolerance establishment", "pdb_count": 7, "pdb_ids": [ "1J8I", "1J9O", "2HDM", "2JP1", "2N54", "2NYZ", "9AST" ], "grounding": [ { "paper": "JAK-STAT1 as therapeutic target for EGFR deficiency-associated inflammation and scarring alopecia", "quote": "Cd163l1 St6galnac3 Tox Bnc2 Auts2 Gphn Dock2 Arhgap15 Inpp4b Cd8b1 Ccl5 Nkg7 Krt17 Cst6 Defb6 Fgfbp1 Igfbp4 Mgst1 H2−Aa Mfge8 Cd74 Ctla4 Frmd5 Ikzf2 Cd7 Cd3e Cd3g Cxcl14 Krt5 Gzmc Xcl1 Ctsw Cxcl2 S100a9 S100a8 Hist1h2ae Stmn1 Tubb5 Dct Ptgds Pmel Cd86 Malt1 Dennd4a Krt1 Stfa3 Cstdc5 Identity Percent", "n_hits": 2 } ], "grounded_in_corpus": true }, { "gene": "XCL2", "name": "X-C motif chemokine ligand 2", "diseases": [ "AA" ], "pathway": "Chemokine", "twin_node": "INF", "effect": "+", "role": "driver", "drugs": [], "mechanism": "XCL2 is upregulated in lesional AA, contributing to chemotactic recruitment of cytotoxic immune cells around hair follicles.", "evidence_paper_ids": [ "41740930" ], "n_evidence": 1, "mention_count": 0, "sources": [ "extract" ], "in_model": false, "uncertain": false, "structure": { "accession": "Q9UBD3", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/Q9UBD3", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-Q9UBD3-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-Q9UBD3-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/Q9UBD3", "mean_plddt": 80.7, "plddt_band": "Confident (70–90)", "n_residues": 114, "local_pdb": "digital_twin\\data\\structures\\Q9UBD3_AF.pdb" }, "uniprot": "Q9UBD3", "uniprot_name": "Cytokine SCM-1 beta", "length": 114, "function": "Chemotactic activity for lymphocytes but not for monocytes or neutrophils", "pdb_count": 0, "pdb_ids": [], "grounding": [], "grounded_in_corpus": false }, { "gene": "ATF4", "name": "Activating transcription factor 4", "diseases": [ "AGA" ], "pathway": "integrated stress response effector", "twin_node": "—", "effect": "?", "role": "modulator", "drugs": [], "mechanism": "Selectively translated upon eIF2alpha phosphorylation; ATF4 and its target ADM2 are upregulated in stressed human follicles and impose a cell-cycle block, positioning ATF4 as the transcriptional node coupling follicular metabolic stress to growth arrest.", "evidence_paper_ids": [], "n_evidence": 0, "mention_count": 0, "sources": [ "discover:recent2024_gwas_trials" ], "in_model": false, "uncertain": false, "structure": { "accession": "P18848", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/P18848", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-P18848-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-P18848-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/P18848", "mean_plddt": 62.0, "plddt_band": "Low (50–70)", "n_residues": 351, "local_pdb": "digital_twin\\data\\structures\\P18848_AF.pdb" }, "uniprot": "P18848", "uniprot_name": "Cyclic AMP-dependent transcription factor ATF-4", "length": 351, "function": "Transcription factor that binds the cAMP response element (CRE) (consensus: 5'-GTGACGT[AC][AG]-3') and displays two biological functions, as regulator of metabolic and redox processes under normal cellular conditions, and as master transcription factor during integrated stress response (ISR) (PubMed:16682973, PubMed:17684156, PubMed:31023583, PubMed:31444471, PubMed:32132707). Binds to asymmetric CRE's as a heterodimer and to palindromic CRE's as a homodimer (By similarity). Core effector of the ISR, which is required for adaptation to various stress such as endoplasmic reticulum (ER) stress, ", "pdb_count": 1, "pdb_ids": [ "1CI6" ], "grounding": [], "grounded_in_corpus": false }, { "gene": "ATG5", "name": "Autophagy protein 5", "diseases": [ "AGA" ], "pathway": "Macroautophagy", "twin_node": "APO", "effect": "-", "role": "protector", "drugs": [], "mechanism": "Core autophagy conjugation-system protein that maintains follicle stem-cell quality control and supports the metabolic transition into the growth phase.", "evidence_paper_ids": [], "n_evidence": 0, "mention_count": 0, "sources": [ "discover:HFSC" ], "in_model": false, "uncertain": false, "structure": { "accession": "Q9H1Y0", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/Q9H1Y0", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-Q9H1Y0-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-Q9H1Y0-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/Q9H1Y0", "mean_plddt": 93.2, "plddt_band": "Very high (≥90)", "n_residues": 275, "local_pdb": "digital_twin\\data\\structures\\Q9H1Y0_AF.pdb" }, "uniprot": "Q9H1Y0", "uniprot_name": "Autophagy protein 5", "length": 275, "function": "Involved in autophagic vesicle formation. Conjugation with ATG12, through a ubiquitin-like conjugating system involving ATG7 as an E1-like activating enzyme and ATG10 as an E2-like conjugating enzyme, is essential for its function. The ATG12-ATG5 conjugate acts as an E3-like enzyme which is required for lipidation of ATG8 family proteins and their association to the vesicle membranes. Involved in mitochondrial quality control after oxidative damage, and in subsequent cellular longevity. Plays a critical role in multiple aspects of lymphocyte development and is essential for both B and T lympho", "pdb_count": 9, "pdb_ids": [ "4GDK", "4GDL", "4NAW", "4TQ0", "4TQ1", "5D7G", "5NPV", "5NPW" ], "grounding": [ { "paper": "ISEV2025 Abstract Book.", "quote": "- cal microscopy, super-resolution nanoscopy (Lattice SIM2 and STED) on both fixed and live cells, and transmission electron microscopy (TEM) with or without immunogold labelling. ATG5 and Rab27a genes were silenced using siRNAs, and protein anal- ysis was conducted by Western blotting. We modulated", "n_hits": 3 }, { "paper": "Impaired autophagy promotes hair loss in the C3H HeJ mouse model of alopecia areata", "quote": "privilege collapse and alopecia areata pathogenesis? J Dermatol Sci. 2020 Oct;100(1):75–78. [21] Brooks CR, Yeung MY, Brooks YS, et al. KIM-1-/TIM-1-mediated phagocytosis links ATG5-/ULK1-dependent clearance of apopto­ tic cells to antigen presentation. EMBO J. 2015 Oct 1 34 (19):2441–2464. [22] Doo", "n_hits": 2 } ], "grounded_in_corpus": true }, { "gene": "ATG7", "name": "Ubiquitin-like modifier-activating enzyme ATG7", "diseases": [ "AGA" ], "pathway": "Macroautophagy", "twin_node": "APO", "effect": "-", "role": "protector", "drugs": [], "mechanism": "E1-like autophagy enzyme required for autophagosome formation that sustains follicle stem-cell proteostasis and promotes anagen entry; its loss accelerates hair greying/loss.", "evidence_paper_ids": [], "n_evidence": 0, "mention_count": 0, "sources": [ "discover:HFSC" ], "in_model": false, "uncertain": false, "structure": { "accession": "O95352", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/O95352", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-O95352-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-O95352-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/O95352", "mean_plddt": 87.6, "plddt_band": "Confident (70–90)", "n_residues": 703, "local_pdb": "digital_twin\\data\\structures\\O95352_AF.pdb" }, "uniprot": "O95352", "uniprot_name": "Ubiquitin-like modifier-activating enzyme ATG7", "length": 703, "function": "E1-like activating enzyme involved in the 2 ubiquitin-like systems required for cytoplasm to vacuole transport (Cvt) and autophagy. Activates ATG12 for its conjugation with ATG5 as well as the ATG8 family proteins for their conjugation with phosphatidylethanolamine. Both systems are needed for the ATG8 association to Cvt vesicles and autophagosomes membranes. Required for autophagic death induced by caspase-8 inhibition. Facilitates LC3-I lipidation with phosphatidylethanolamine to form LC3-II which is found on autophagosomal membranes (PubMed:34161705). Required for mitophagy which contribute", "pdb_count": 0, "pdb_ids": [], "grounding": [], "grounded_in_corpus": false }, { "gene": "AXL", "name": "Tyrosine-protein kinase receptor UFO (AXL)", "diseases": [ "AGA", "TelogenEffluvium" ], "pathway": "GAS6-AXL/TAM receptor (HFSC activation)", "twin_node": "HFSC", "effect": "+", "role": "protector", "drugs": [ "AXL agonists (preclinical)" ], "mechanism": "Most highly expressed TAM receptor on hair follicle stem cells; receives the GAS6 signal to trigger HFSC proliferation and anagen onset. Pharmacologic AXL agonism is proposed to overcome stress-induced telogen prolongation; the GAS6-AXL node is an emerging druggable receptor target outside the androgen/WNT canon.", "evidence_paper_ids": [], "n_evidence": 0, "mention_count": 0, "sources": [ "discover:recent" ], "in_model": false, "uncertain": false, "structure": { "accession": "P30530", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/P30530", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-P30530-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-P30530-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/P30530", "mean_plddt": 75.1, "plddt_band": "Confident (70–90)", "n_residues": 894, "local_pdb": "digital_twin\\data\\structures\\P30530_AF.pdb" }, "uniprot": "P30530", "uniprot_name": "Tyrosine-protein kinase receptor UFO", "length": 894, "function": "Receptor tyrosine kinase that transduces signals from the extracellular matrix into the cytoplasm by binding growth factor GAS6 and which is thus regulating many physiological processes including cell survival, cell proliferation, migration and differentiation. Ligand binding at the cell surface induces dimerization and autophosphorylation of AXL. Following activation by ligand, AXL binds and induces tyrosine phosphorylation of PI3-kinase subunits PIK3R1, PIK3R2 and PIK3R3; but also GRB2, PLCG1, LCK and PTPN11. Other downstream substrate candidates for AXL are CBL, NCK2, SOCS1 and TNS2. Recrui", "pdb_count": 4, "pdb_ids": [ "2C5D", "4RA0", "5U6B", "5VXZ" ], "grounding": [ { "paper": "ISEV2025 Abstract Book.", "quote": "which was serially sampled at three time points). For these experiments, EVs were captured into the EV-HB-Chips using a cocktail of antibodies targeting EGFR, podoplanin, PDGF and Axl. The results showed successful detection of some of the brain tumour specific genes (EGFR, MYCN) using ddPCR followi", "n_hits": 16 }, { "paper": "Triton modified polyethyleneimine conjugates assembled with growth arrest-specific protein 6 for androgenetic alopecia transdermal gene therapy", "quote": "(Gas6) is a soluble glycoprotein that was first identified in mouse embryonic fibroblasts and is involved in the stimulation of cell prolifer- ation. After binding to its receptors (AXL, TYPO3 and MER), Gas6 acti- vates tyrosine kinase activity and plays an important role in cell proliferation, surviva", "n_hits": 2 } ], "grounded_in_corpus": true }, { "gene": "BCL2L11", "name": "BCL2 like 11 (BIM)", "diseases": [ "AA" ], "pathway": "intrinsic apoptosis / immune tolerance", "twin_node": "INF", "effect": "+", "role": "driver", "drugs": [], "mechanism": "Genome-wide significant AA locus at 2q13 (ACOXL/BCL2L11); BIM is a pro-apoptotic BH3-only protein required for deletion of autoreactive T cells, so dysregulation impairs negative selection and promotes autoimmune follicular attack.", "evidence_paper_ids": [], "n_evidence": 0, "mention_count": 0, "sources": [ "discover:recent2024_gwas_trials" ], "in_model": false, "uncertain": false, "structure": { "accession": "O43521", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/O43521", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-O43521-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-O43521-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/O43521", "mean_plddt": 60.1, "plddt_band": "Low (50–70)", "n_residues": 198, "local_pdb": "digital_twin\\data\\structures\\O43521_AF.pdb" }, "uniprot": "O43521", "uniprot_name": "Bcl-2-like protein 11", "length": 198, "function": "Induces apoptosis and anoikis. Isoform BimL is more potent than isoform BimEL. Isoform Bim-alpha1, isoform Bim-alpha2 and isoform Bim-alpha3 induce apoptosis, although less potent than isoform BimEL, isoform BimL and isoform BimS. Isoform Bim-gamma induces apoptosis. Isoform Bim-alpha3 induces apoptosis possibly through a caspase-mediated pathway. Isoform BimAC and isoform BimABC lack the ability to induce apoptosis", "pdb_count": 45, "pdb_ids": [ "1F95", "2K7W", "2NL9", "2V6Q", "2VM6", "2WH6", "2YQ6", "2YQ7" ], "grounding": [ { "paper": "Impaired autophagy promotes hair loss in the C3H HeJ mouse model of alopecia areata", "quote": "hich leads to hair loss. Previous genetic data from our lab pointed to a connection between macroautophagy/auto­ phagy and AA pathogenesis, and GWAS identified STX17, CLEC16A and BCL2L11/BIM as risk factors for AA. Additionally, AA patients have copy number deletions in region spanning the ATG4B gen", "n_hits": 2 } ], "grounded_in_corpus": true }, { "gene": "CALCA", "name": "Calcitonin gene-related peptide (CGRP)", "diseases": [ "AA", "CIA" ], "pathway": "Sensory neuropeptide restoration of immune privilege", "twin_node": "INF", "effect": "-", "role": "protector", "drugs": [ "CGRP analogs / capsaicin-induced CGRP release (concept)" ], "mechanism": "CGRP released from perifollicular sensory nerves is immunoinhibitory: it suppresses IFN-gamma-induced perifollicular mast-cell degranulation and helps restore collapsed hair-follicle immune privilege in AA. Promoting CGRP/neuropeptide signaling is an emerging neuro-immune protective strategy for autoimmune and scarring alopecias.", "evidence_paper_ids": [], "n_evidence": 0, "mention_count": 0, "sources": [ "discover:recent" ], "in_model": false, "uncertain": false, "structure": { "accession": "P01258", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/P01258", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-P01258-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-P01258-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/P01258", "mean_plddt": 63.9, "plddt_band": "Low (50–70)", "n_residues": 141, "local_pdb": "digital_twin\\data\\structures\\P01258_AF.pdb" }, "uniprot": "P01258", "uniprot_name": "Calcitonin", "length": 141, "function": "Calcitonin is a peptide hormone that causes a rapid but short-lived drop in the level of calcium and phosphate in blood by promoting the incorporation of those ions in the bones. Calcitonin function is mediated by the calcitonin receptor/CALCR and the CALCR-RAMP2 (AMYR2) receptor complex (PubMed:35324283)", "pdb_count": 3, "pdb_ids": [ "2JXZ", "7TYH", "7TYO" ], "grounding": [], "grounded_in_corpus": false }, { "gene": "CASP1", "name": "Caspase-1", "diseases": [ "AA" ], "pathway": "Inflammasome/pyroptosis", "twin_node": "INF", "effect": "+", "role": "driver", "drugs": [], "mechanism": "Inflammasome effector protease that matures IL-1beta/IL-18 and cleaves gasdermin D to execute pyroptosis, contributing to the inflammatory follicular damage in AA.", "evidence_paper_ids": [], "n_evidence": 0, "mention_count": 0, "sources": [ "discover:AA" ], "in_model": false, "uncertain": false, "structure": { "accession": "P29466", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/P29466", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-P29466-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-P29466-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/P29466", "mean_plddt": 81.7, "plddt_band": "Confident (70–90)", "n_residues": 404, "local_pdb": "digital_twin\\data\\structures\\P29466_AF.pdb" }, "uniprot": "P29466", "uniprot_name": "Caspase-1", "length": 404, "function": "Thiol protease involved in a variety of inflammatory processes by proteolytically cleaving other proteins, such as the precursors of the inflammatory cytokines interleukin-1 beta (IL1B) and interleukin 18 (IL18) as well as the pyroptosis inducer Gasdermin-D (GSDMD), into active mature peptides (PubMed:15326478, PubMed:15498465, PubMed:1574116, PubMed:26375003, PubMed:32051255, PubMed:37993714, PubMed:7876192, PubMed:9334240). Plays a key role in cell immunity as an inflammatory response initiator: once activated through formation of an inflammasome complex, it initiates a pro-inflammatory resp", "pdb_count": 40, "pdb_ids": [ "1BMQ", "1IBC", "1ICE", "1RWK", "1RWM", "1RWN", "1RWO", "1RWP" ], "grounding": [ { "paper": "Hair Follicle Stem Cell-Specific PPARγ Deletion Causes Scarring Alopecia", "quote": "of cytokines/chemokines (MIP1, MCP1, CCL27, MMD, IL6, RANTES), extracellular matrix- associated proteins (OPN, MMP1, MMP9, MMP10, MMP28, TIMP4, ADAMTS1), apoptosis-related genes (CASP1, GADD45B, PDCD6, PDCD4, CASP8)., and cell-surface antigens (CD 68, CD 69), suggesting the activation of macrophages", "n_hits": 2 } ], "grounded_in_corpus": true }, { "gene": "CD44", "name": "CD44 antigen (hyaluronan receptor)", "diseases": [ "AGA", "TelogenEffluvium" ], "pathway": "Osteopontin (OPN)-CD44 (HFSC hyperactivation)", "twin_node": "HFSC", "effect": "+", "role": "protector", "drugs": [ "CD44 agonist peptides (preclinical)" ], "mechanism": "Receptor on hair follicle stem cells that transduces the osteopontin signal from senescent melanocytes to drive hair-growth hyperactivation; Cd44-null follicles show markedly delayed regrowth. A surface receptor target for agonism in non-scarring hair loss.", "evidence_paper_ids": [], "n_evidence": 0, "mention_count": 0, "sources": [ "discover:recent" ], "in_model": false, "uncertain": false, "structure": { "accession": "P16070", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/P16070", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-P16070-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-P16070-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/P16070", "mean_plddt": 53.2, "plddt_band": "Low (50–70)", "n_residues": 742, "local_pdb": "digital_twin\\data\\structures\\P16070_AF.pdb" }, "uniprot": "P16070", "uniprot_name": "CD44 antigen", "length": 742, "function": "Cell-surface receptor that plays a role in cell-cell interactions, cell adhesion and migration, helping them to sense and respond to changes in the tissue microenvironment (PubMed:16541107, PubMed:19703720, PubMed:22726066). Participates thereby in a wide variety of cellular functions including the activation, recirculation and homing of T-lymphocytes, hematopoiesis, inflammation and response to bacterial infection (PubMed:7528188). Engages, through its ectodomain, extracellular matrix components such as hyaluronan/HA, collagen, growth factors, cytokines or proteases and serves as a platform f", "pdb_count": 6, "pdb_ids": [ "1POZ", "1UUH", "2I83", "4PZ3", "4PZ4", "6TXS" ], "grounding": [ { "paper": "ISEV2025 Abstract Book.", "quote": "llular Vesicle Monitoring Phenotypic Analyzer Chip (GEMPAC), which pro- files a novel central nervous system (CNS) and glioma stem cell (GSC) biomarker panel (ATP1B2, EAAT2, CD24, CD44, CD133, and EGFR) on circulating sEVs. Methods: GEMPAC identifies a unique GBM signature in sEVs by targeting CNS-s", "n_hits": 39 }, { "paper": "Induction of T cell exhaustion by JAK1 3 inhibition in the treatment of alopecia areata", "quote": "r regrowth in AA-affected C3H/HeJ mice when fed with Ifidancitinib in chow diets. Skin taken from Ifidancitinib-treated mice showed significantly decreased AA-associated inflammation. CD44+CD62L- CD8+ T effector/memory cells, which are associated with the pathogenesis of AA, were significantly decreased ", "n_hits": 14 }, { "paper": "TH1 effector CD4 T cells rely on IFN-γ production to induce alopecia areata", "quote": "actors (TFs), cytokine signaling, and chemokine signaling. In CD4 T cells from AA mice, we ob- served an increase in expression of several genes related to activa- tion including Cd44, Pdcd1, Icos, and Ctla4 (Fig. 3C). We also found several genes with increased expression relating to TH1 differentia", "n_hits": 14 }, { "paper": "Mechanistic study of Erianin in alopecia areata", "quote": "nd MHC II in the skin of Erianin- treated mice (Figure 2C). Flow cytometric ana- lysis further demonstrated a significant de- crease in the frequency of CD8+NKG2D+ T cell and CD8+CD44+CD62L- T cell infiltration fol­ lowing Erianin treatment (Figure 2D, 2E). Similarly, a notable reduction in CD8+CD44", "n_hits": 6 } ], "grounded_in_corpus": true }, { "gene": "CD8A", "name": "T-cell surface glycoprotein CD8 alpha chain", "diseases": [ "AA" ], "pathway": "Cytotoxic immunity", "twin_node": "—", "effect": "?", "role": "driver", "drugs": [], "mechanism": "Defines the CD8+ cytotoxic T lymphocytes that are the primary effector cells executing follicular damage in AA, recognizing follicular autoantigens via MHC class I.", "evidence_paper_ids": [], "n_evidence": 0, "mention_count": 0, "sources": [ "discover:AA" ], "in_model": false, "uncertain": false, "structure": { "accession": "P01732", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/P01732", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-P01732-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-P01732-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/P01732", "mean_plddt": 78.2, "plddt_band": "Confident (70–90)", "n_residues": 235, "local_pdb": "digital_twin\\data\\structures\\P01732_AF.pdb" }, "uniprot": "P01732", "uniprot_name": "T-cell surface glycoprotein CD8 alpha chain", "length": 235, "function": "Integral membrane glycoprotein that plays an essential role in the immune response and serves multiple functions in responses against both external and internal offenses. In T-cells, functions primarily as a coreceptor for MHC class I molecule:peptide complex. The antigens presented by class I peptides are derived from cytosolic proteins while class II derived from extracellular proteins. Interacts simultaneously with the T-cell receptor (TCR) and the MHC class I proteins presented by antigen presenting cells (APCs). In turn, recruits the Src kinase LCK to the vicinity of the TCR-CD3 complex. ", "pdb_count": 8, "pdb_ids": [ "1AKJ", "1CD8", "1Q69", "2HP4", "3QZW", "7UMG", "7UVF", "8EW6" ], "grounding": [ { "paper": "Impaired autophagy promotes hair loss in the C3H HeJ mouse model of alopecia areata", "quote": "cell suspen­ sions isolated from skin and SDLN of Tat-SCRAMBLE or Tat- BECN1 treated AA mice (Figure S1). We found no statistical differences in the proportion of total CD4+ or CD8A+ T cells, CD4+ FOXP3+ Tregs, or KLRK1-, GZMB- or IFNG-expressing CD8A+ T cell subsets in either the skin or in SDLN (F", "n_hits": 5 }, { "paper": "Selective Janus kinase 1 inhibition resolves inflammation and restores hair growth offering a viable treatment option for alopecia areata", "quote": "and incubated with epitope retrieval so- lution 2 for 15 min at 88°C followed by ACD protease for 10 min before hybridization with probe Mm‐Klrk1 (ACD, Cat.No.430808) and probe Mm‐Cd8a‐C2 (ACD, Cat. No. 401688‐C2) or duplex negative control probes Mm‐ DapB (ACD, Cat.No. 320758). Bound probe was visu", "n_hits": 4 }, { "paper": "Ox40-Cre–mediated deletion of BRD4 reveals an unexpected phenotype of hair follicle stem cells in alopecia", "quote": "nd 100414 CD44 IM7 BioLegend 103032 CD45 30-F11 BioLegend 103106 CD45.1 A20 BioLegend 110743 CD49f GoH3 BioLegend 313622 CD69 H1.2F3 BioLegend 104514 CD62L MEL-14 BioLegend 104408 CD8a 53-6.7 BioLegend 100725 CD8a 53-6.7 BioLegend 100706 Brd4 Polyclonal Bethyl A301-985A-M Foxp3 FJK-16s Invitrogen 48", "n_hits": 2 } ], "grounded_in_corpus": true }, { "gene": "CDKN1A", "name": "Cyclin-dependent kinase inhibitor 1 (p21)", "diseases": [ "AGA", "CIA" ], "pathway": "Cell-cycle/apoptosis (p53)", "twin_node": "APO", "effect": "?", "role": "modulator", "drugs": [], "mechanism": "A p53 transcriptional target that arrests the cell cycle in proliferating matrix keratinocytes, transiently protecting follicles from cytotoxic S-phase damage and modulating CIA severity.", "evidence_paper_ids": [], "n_evidence": 0, "mention_count": 0, "sources": [ "discover:CIA", "discover:HFSC" ], "in_model": false, "uncertain": false, "structure": { "accession": "P38936", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/P38936", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-P38936-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-P38936-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/P38936", "mean_plddt": 69.0, "plddt_band": "Low (50–70)", "n_residues": 164, "local_pdb": "digital_twin\\data\\structures\\P38936_AF.pdb" }, "uniprot": "P38936", "uniprot_name": "Cyclin-dependent kinase inhibitor 1", "length": 164, "function": "Plays an important role in controlling cell cycle progression and DNA damage-induced G2 arrest (PubMed:9106657). Involved in p53/TP53 mediated inhibition of cellular proliferation in response to DNA damage. Also involved in p53-independent DNA damage-induced G2 arrest mediated by CREB3L1 in astrocytes and osteoblasts (By similarity). Binds to and inhibits cyclin-dependent kinase activity, preventing phosphorylation of critical cyclin-dependent kinase substrates and blocking cell cycle progression. Functions in the nuclear localization and assembly of cyclin D-CDK4 complex and promotes its kina", "pdb_count": 13, "pdb_ids": [ "1AXC", "2ZVV", "2ZVW", "4RJF", "5E0U", "6CBI", "6CEJ", "6CIV" ], "grounding": [ { "paper": "Promotion of Hair Regrowth in Androgenetic Alopecia with Supplemented Erzhi Wan Exploring Its Mechanism Using Network Pharmacology and Molecular Docking", "quote": "cetin CAMKMT Mohanlian MOL001689 Acacetin CHEK1 Mohanlian MOL001689 Acacetin ADRB2 Mohanlian MOL001689 Acacetin RELA Mohanlian MOL001689 Acacetin BCL2 Mohanlian MOL001689 Acacetin CDKN1A Mohanlian MOL001689 Acacetin BAX Mohanlian MOL001689 Acacetin CASP3 Mohanlian MOL001689 Acacetin TP53 Mohanlian M", "n_hits": 5 } ], "grounded_in_corpus": true }, { "gene": "CDKN2A", "name": "Cyclin-dependent kinase inhibitor 2A (p16INK4a)", "diseases": [ "AGA" ], "pathway": "p16-Rb senescence", "twin_node": "APO", "effect": "+", "role": "driver", "drugs": [ "Navitoclax", "Senolytics (Dasatinib+Quercetin)" ], "mechanism": "Cell-cycle inhibitor that accumulates in aging follicle stem cells to enforce senescence, depleting the regenerative niche and contributing to age-related hair thinning.", "evidence_paper_ids": [], "n_evidence": 0, "mention_count": 0, "sources": [ "discover:HFSC" ], "in_model": false, "uncertain": false, "structure": { "accession": "P42771", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/P42771", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-P42771-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-P42771-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/P42771", "mean_plddt": 76.3, "plddt_band": "Confident (70–90)", "n_residues": 156, "local_pdb": "digital_twin\\data\\structures\\P42771_AF.pdb" }, "uniprot": "P42771", "uniprot_name": "Cyclin-dependent kinase inhibitor 2A", "length": 156, "function": "Acts as a negative regulator of the proliferation of normal cells by interacting strongly with CDK4 and CDK6. This inhibits their ability to interact with cyclins D and to phosphorylate the retinoblastoma protein", "pdb_count": 5, "pdb_ids": [ "1A5E", "1BI7", "1DC2", "2A5E", "7OZT" ], "grounding": [ { "paper": "Rejuvenating senescent hair follicles a novel conjugated linoleic acid based nanovesicle approach to treat androgenic alopecia", "quote": "ed genes The expression of DHT-induced related genes [SRD5A2, β-Catenin, Fibroblast growth factor-7 (FGF-7), Insulin- like Growth Factor 1 (IGF-1)] and cell cycle related genes (CDKN2A and p53) in HDPCs wereexamined using real- time fluorescence quantitative PCR (RT-qPCR). Briefly, HDPCs were seeded", "n_hits": 5 } ], "grounded_in_corpus": true }, { "gene": "CLEC16A", "name": "C-type lectin domain containing 16A", "diseases": [ "AA" ], "pathway": "autophagy / immune regulation (KIAA0350 locus)", "twin_node": "INF", "effect": "+", "role": "driver", "drugs": [], "mechanism": "GWAS susceptibility locus (16p13.13) at the IL2RA-adjacent autoimmune region; regulates autophagy/mitophagy and T-cell tolerance, contributing to loss of hair-follicle immune privilege and CD8+ T-cell autoimmunity.", "evidence_paper_ids": [], "n_evidence": 0, "mention_count": 0, "sources": [ "discover:recent2024_gwas_trials" ], "in_model": false, "uncertain": false, "structure": { "accession": "Q2KHT3", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/Q2KHT3", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-Q2KHT3-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-Q2KHT3-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/Q2KHT3", "mean_plddt": 70.8, "plddt_band": "Confident (70–90)", "n_residues": 1053, "local_pdb": "digital_twin\\data\\structures\\Q2KHT3_AF.pdb" }, "uniprot": "Q2KHT3", "uniprot_name": "Protein CLEC16A", "length": 1053, "function": "Regulator of mitophagy through the upstream regulation of the RNF41/NRDP1-PRKN pathway. Mitophagy is a selective form of autophagy necessary for mitochondrial quality control. The RNF41/NRDP1-PRKN pathway regulates autophagosome-lysosome fusion during late mitophagy. May protect RNF41/NRDP1 from proteasomal degradation, RNF41/NRDP1 which regulates proteasomal degradation of PRKN. Plays a key role in beta cells functions by regulating mitophagy/autophagy and mitochondrial health", "pdb_count": 0, "pdb_ids": [], "grounding": [ { "paper": "Impaired autophagy promotes hair loss in the C3H HeJ mouse model of alopecia areata", "quote": "icle (HF), which leads to hair loss. Previous genetic data from our lab pointed to a connection between macroautophagy/auto­ phagy and AA pathogenesis, and GWAS identified STX17, CLEC16A and BCL2L11/BIM as risk factors for AA. Additionally, AA patients have copy number deletions in region spanning t", "n_hits": 2 } ], "grounded_in_corpus": true }, { "gene": "COL17A1", "name": "Collagen type XVII alpha 1 chain (BP180)", "diseases": [ "AGA" ], "pathway": "hemidesmosome basement-membrane anchorage / HFSC maintenance", "twin_node": "HFSC", "effect": "+", "role": "protector", "drugs": [], "mechanism": "DNA-damage-induced proteolysis of COL17A1 triggers transepidermal elimination of hair-follicle stem cells, loss of stemness and follicle miniaturization; its depletion is a central senescence mechanism in age-related and pattern hair thinning.", "evidence_paper_ids": [], "n_evidence": 0, "mention_count": 0, "sources": [ "discover:recent2024_gwas_trials" ], "in_model": false, "uncertain": false, "structure": { "accession": "Q9UMD9", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/Q9UMD9", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-Q9UMD9-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-Q9UMD9-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/Q9UMD9", "mean_plddt": 46.9, "plddt_band": "Very low (<50)", "n_residues": 1497, "local_pdb": "digital_twin\\data\\structures\\Q9UMD9_AF.pdb" }, "uniprot": "Q9UMD9", "uniprot_name": "Collagen alpha-1(XVII) chain", "length": 1497, "function": "May play a role in the integrity of hemidesmosome and the attachment of basal keratinocytes to the underlying basement membrane", "pdb_count": 1, "pdb_ids": [ "8IZS" ], "grounding": [ { "paper": "Engineered collagen XVII-loaded dissolving microneedle patch for promoting hair regrowth in androgenic alopecia", "quote": "ore component of hemidesmosomes, has emerged as a critical molecular hub connecting the cytoskeleton to the ECM [16, 17]. COL17, a transmembrane collagen protein encoded by the COL17A1 gene, plays a pivotal role in anchoring epidermal basal cells to the basement membrane through its trimeric Receive", "n_hits": 7 } ], "grounded_in_corpus": true }, { "gene": "CXCL11", "name": "C-X-C motif chemokine ligand 11 (I-TAC)", "diseases": [ "AA" ], "pathway": "CXCR3 chemokine axis", "twin_node": "INF", "effect": "+", "role": "driver", "drugs": [], "mechanism": "The highest-affinity CXCR3 ligand, IFN-gamma-induced, reinforcing recruitment of cytotoxic effector T cells into the AA hair follicle.", "evidence_paper_ids": [], "n_evidence": 0, "mention_count": 0, "sources": [ "discover:AA" ], "in_model": false, "uncertain": false, "structure": { "accession": "O14625", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/O14625", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-O14625-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-O14625-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/O14625", "mean_plddt": 80.0, "plddt_band": "Confident (70–90)", "n_residues": 94, "local_pdb": "digital_twin\\data\\structures\\O14625_AF.pdb" }, "uniprot": "O14625", "uniprot_name": "C-X-C motif chemokine 11", "length": 94, "function": "Chemotactic for interleukin-activated T-cells but not unstimulated T-cells, neutrophils or monocytes. Induces calcium release in activated T-cells. Binds to CXCR3. May play an important role in CNS diseases which involve T-cell recruitment. May play a role in skin immune responses", "pdb_count": 2, "pdb_ids": [ "1RJT", "8HNK" ], "grounding": [ { "paper": "CXCR3 Blockade Inhibits T-cell Migration into the Skin and Prevents Development of Alopecia Areata", "quote": "in a wide range of disease processes, including infection, autoimmune, inflammatory, and malignant diseases (12–14). The CXCR3 receptor and its cognate ligands, CXCL9, CXCL10 and CXCL11 have been implicated in directing a Th1 inflammatory response (15–18). Recent studies support the notion that the ", "n_hits": 37 }, { "paper": "Modulating immune responses in alopecia therapeutic insights and potential targets of antisense oligonucleotides", "quote": "en hair loss, with interferon-gamma (IFN-γ) playing a pivotal role in pathogenesis. The upregulation of IFN response genes, including IFN-inducible chemokines CXCL9, CXCL10, and CXCL11, in lesional skin reflects the activation of the IFN response pathway and contributes to immune cell recruitment an", "n_hits": 13 }, { "paper": "Induction of alopecia areata in C3H HeJ mice using polyinosinic-polycytidylic acid (poly[IC]) and interferon-gamma", "quote": "ns revealed increased infiltration of CD4+ and CD8+ cells infiltration around the hair follicles. IFNγ and poly(I:C) increased the expression of NLRP3, IL-1β, CXCL9, CXCL10, and CXCL11 in mouse skin. Taken together, these findings indicate a shorter and more convenient means of AA animal model induc", "n_hits": 4 }, { "paper": "Selective Janus kinase 1 inhibition resolves inflammation and restores hair growth offering a viable treatment option for alopecia areata", "quote": "ih.gov/geo/query/ acc.cgi?acc=GSE94235) and GSE94236 (mouse skin samples) (https://www.ncbi.nlm.nih.gov/geo/query/acc. cgi?acc=GSE94236). 2.4.6 | ALADIN scores IFN (Cxcl9, Cxcl10, Cxcl11, Stat1, and Mx1) and CTL (Cd8a, Gzmb, Icos, Prf1) ALADIN scores for the Taq- man data were calculated for each gr", "n_hits": 3 } ], "grounded_in_corpus": true }, { "gene": "CXXC5", "name": "CXXC-type zinc finger protein 5", "diseases": [ "AGA", "TelogenEffluvium" ], "pathway": "WNT/beta-catenin (negative feedback via Dishevelled)", "twin_node": "Wnt", "effect": "-", "role": "driver", "drugs": [ "PTD-DBM (peptide, preclinical/early clinical)" ], "mechanism": "Negative regulator of WNT/beta-catenin that binds Dishevelled; upregulated in miniaturized follicles and arrector pili of balding scalp. Competing peptides (PTD-DBM) that disrupt the CXXC5-Dvl interaction de-repress WNT signaling and induce hair regrowth and wound-induced follicle neogenesis. A non-classic, druggable intracellular brake on the canonical hair-growth pathway.", "evidence_paper_ids": [], "n_evidence": 0, "mention_count": 0, "sources": [ "discover:recent" ], "in_model": false, "uncertain": false, "structure": { "accession": "Q7LFL8", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/Q7LFL8", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-Q7LFL8-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-Q7LFL8-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/Q7LFL8", "mean_plddt": 59.1, "plddt_band": "Low (50–70)", "n_residues": 322, "local_pdb": "digital_twin\\data\\structures\\Q7LFL8_AF.pdb" }, "uniprot": "Q7LFL8", "uniprot_name": "CXXC-type zinc finger protein 5", "length": 322, "function": "May indirectly participate in activation of the NF-kappa-B and MAPK pathways. Acts as a mediator of BMP4-mediated modulation of canonical Wnt signaling activity in neural stem cells (By similarity). Required for DNA damage-induced ATM phosphorylation, p53 activation and cell cycle arrest. Involved in myelopoiesis. Transcription factor. Binds to the oxygen responsive element of COX4I2 and represses its transcription under hypoxia conditions (4% oxygen), as well as normoxia conditions (20% oxygen) (PubMed:23303788). May repress COX4I2 transactivation induced by CHCHD2 and RBPJ (PubMed:23303788).", "pdb_count": 1, "pdb_ids": [ "5W9S" ], "grounding": [], "grounded_in_corpus": false }, { "gene": "CYP1B1", "name": "Cytochrome P450 family 1 subfamily B member 1", "diseases": [ "CIA" ], "pathway": "xenobiotic/estrogen metabolism (2p22 locus)", "twin_node": "—", "effect": "?", "role": "protector", "drugs": [], "mechanism": "GWAS-implicated causal missense allele (p.Asn453Ser) in the heme-binding domain is protective in FFA; CYP1B1 metabolizes xenobiotics and estrogens, linking hormonal/environmental processing to follicular immune-mediated fibrosis.", "evidence_paper_ids": [], "n_evidence": 0, "mention_count": 0, "sources": [ "discover:recent2024_gwas_trials" ], "in_model": false, "uncertain": false, "structure": { "accession": "Q16678", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/Q16678", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-Q16678-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-Q16678-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/Q16678", "mean_plddt": 92.2, "plddt_band": "Very high (≥90)", "n_residues": 543, "local_pdb": "digital_twin\\data\\structures\\Q16678_AF.pdb" }, "uniprot": "Q16678", "uniprot_name": "Cytochrome P450 1B1", "length": 543, "function": "A cytochrome P450 monooxygenase involved in the metabolism of various endogenous substrates, including fatty acids, steroid hormones and vitamins (PubMed:10681376, PubMed:11555828, PubMed:12865317, PubMed:15258110, PubMed:20972997). Mechanistically, uses molecular oxygen inserting one oxygen atom into a substrate, and reducing the second into a water molecule, with two electrons provided by NADPH via cytochrome P450 reductase (NADPH--hemoprotein reductase) (PubMed:10681376, PubMed:11555828, PubMed:12865317, PubMed:15258110, PubMed:20972997). Exhibits catalytic activity for the formation of hyd", "pdb_count": 2, "pdb_ids": [ "3PM0", "6IQ5" ], "grounding": [ { "paper": "Promotion of Hair Regrowth in Androgenetic Alopecia with Supplemented Erzhi Wan Exploring Its Mechanism Using Network Pharmacology and Molecular Docking", "quote": "OS3 Mohanlian MOL000098 Quercetin HSPB1 Mohanlian MOL000098 Quercetin SULT1E1 Mohanlian MOL000098 Quercetin IL2RA Mohanlian MOL000098 Quercetin NR1I2 Mohanlian MOL000098 Quercetin CYP1B1 Mohanlian MOL000098 Quercetin CCNB1 Mohanlian MOL000098 Quercetin PLAT Mohanlian MOL000098 Quercetin THBD Mohanli", "n_hits": 3 } ], "grounded_in_corpus": true }, { "gene": "DLX3", "name": "Homeobox protein DLX-3", "diseases": [ "CIA" ], "pathway": "Transcription factor", "twin_node": "—", "effect": "?", "role": "modulator", "drugs": [], "mechanism": "Homeodomain transcription factor essential for hair-matrix differentiation and hair-keratin gene activation; its mutation (Tricho-Dento-Osseous syndrome) produces kinky, fragile hair and disrupted cycling.", "evidence_paper_ids": [], "n_evidence": 0, "mention_count": 0, "sources": [ "discover:CIA" ], "in_model": false, "uncertain": false, "structure": { "accession": "O60479", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/O60479", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-O60479-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-O60479-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/O60479", "mean_plddt": 60.1, "plddt_band": "Low (50–70)", "n_residues": 287, "local_pdb": "digital_twin\\data\\structures\\O60479_AF.pdb" }, "uniprot": "O60479", "uniprot_name": "Homeobox protein DLX-3", "length": 287, "function": "Transcriptional activator (By similarity). Activates transcription of GNRHR, via binding to the downstream activin regulatory element (DARE) in the gene promoter (By similarity)", "pdb_count": 1, "pdb_ids": [ "4XRS" ], "grounding": [ { "paper": "Ox40-Cre–mediated deletion of BRD4 reveals an unexpected phenotype of hair follicle stem cells in alopecia", "quote": "omatin modifications (37). We explored the published super enhancer database in follicle stem cells (27), and we found that some lineage transcription factors (Lhx2, Nfib, Sox9, Dlx3) and key signaling factors (Lef1, Frfr2, Id1, Lgr4 for Wnt pathway; Gas1, Hes1, Gli1, ptch2 for SHH pathway; Cdk4, Cc", "n_hits": 2 } ], "grounded_in_corpus": true }, { "gene": "EIF2AK4", "name": "Eukaryotic translation initiation factor 2 alpha kinase 4 (GCN2)", "diseases": [ "AGA" ], "pathway": "integrated stress response (eIF2alpha-ATF4)", "twin_node": "—", "effect": "?", "role": "modulator", "drugs": [], "mechanism": "GCN2 senses amino-acid deprivation and phosphorylates eIF2alpha to trigger the integrated stress response in follicles; ISRIB-mediated ISR inhibition relieves the MPC-induced proliferative block, making the ISR a metabolic lever for hair growth.", "evidence_paper_ids": [], "n_evidence": 0, "mention_count": 0, "sources": [ "discover:recent2024_gwas_trials" ], "in_model": false, "uncertain": false, "structure": { "accession": "Q9P2K8", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/Q9P2K8", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-Q9P2K8-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-Q9P2K8-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/Q9P2K8", "mean_plddt": 72.9, "plddt_band": "Confident (70–90)", "n_residues": 1649, "local_pdb": "digital_twin\\data\\structures\\Q9P2K8_AF.pdb" }, "uniprot": "Q9P2K8", "uniprot_name": "eIF-2-alpha kinase GCN2", "length": 1649, "function": "Metabolic-stress sensing protein kinase that phosphorylates the alpha subunit of eukaryotic translation initiation factor 2 (EIF2S1/eIF-2-alpha) in response to low amino acid availability (PubMed:25329545, PubMed:32610081). Plays a role as an activator of the integrated stress response (ISR) required for adaptation to amino acid starvation (By similarity). EIF2S1/eIF-2-alpha phosphorylation in response to stress converts EIF2S1/eIF-2-alpha into a global protein synthesis inhibitor, leading to a global attenuation of cap-dependent translation, and thus to a reduced overall utilization of amino ", "pdb_count": 8, "pdb_ids": [ "6N3L", "6N3N", "6N3O", "7E2K", "7E2M", "7QQ6", "7QWK", "8T7T" ], "grounding": [], "grounded_in_corpus": false }, { "gene": "EZH2", "name": "Histone-lysine N-methyltransferase EZH2", "diseases": [ "AGA" ], "pathway": "PRC2 / H3K27me3 repression", "twin_node": "—", "effect": "?", "role": "modulator", "drugs": [ "GSK126 (tool)", "Tazemetostat" ], "mechanism": "Polycomb catalytic subunit depositing H3K27me3 to repress differentiation genes and balance follicle stem-cell self-renewal versus lineage commitment.", "evidence_paper_ids": [], "n_evidence": 0, "mention_count": 0, "sources": [ "discover:HFSC" ], "in_model": false, "uncertain": false, "structure": { "accession": "Q15910", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/Q15910", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-Q15910-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-Q15910-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/Q15910", "mean_plddt": 76.2, "plddt_band": "Confident (70–90)", "n_residues": 746, "local_pdb": "digital_twin\\data\\structures\\Q15910_AF.pdb" }, "uniprot": "Q15910", "uniprot_name": "Histone-lysine N-methyltransferase EZH2", "length": 746, "function": "Catalytic subunit of the PRC2/EED-EZH2 complex, a Polycomb group (PcG) complex that methylates 'Lys-9' (H3K9me) and 'Lys-27' (H3K27me) of histone H3, leading to transcriptional repression of the affected target gene (PubMed:14532106, PubMed:15225548, PubMed:15385962, PubMed:16618801, PubMed:16936726, PubMed:17344414, PubMed:22323599, PubMed:24474760, PubMed:26581166, PubMed:30026490, PubMed:30923826). Able to mono-, di- and trimethylate 'Lys-27' of histone H3 to form H3K27me1, H3K27me2 and H3K27me3, respectively (PubMed:15231737, PubMed:17210787, PubMed:18285464, PubMed:22323599, PubMed:309238", "pdb_count": 38, "pdb_ids": [ "4MI0", "4MI5", "5GSA", "5H14", "5H15", "5H17", "5H19", "5H24" ], "grounding": [], "grounded_in_corpus": false }, { "gene": "F11R", "name": "Junctional adhesion molecule A (JAM-A)", "diseases": [ "AGA" ], "pathway": "Tight-junction adhesion / barrier", "twin_node": "DP", "effect": "?", "role": "modulator", "drugs": [], "mechanism": "Tight-junction adhesion molecule that maintains follicle epithelial barrier integrity and regulates leukocyte transmigration into the perifollicular niche.", "evidence_paper_ids": [], "n_evidence": 0, "mention_count": 0, "sources": [ "discover:HFSC" ], "in_model": false, "uncertain": false, "structure": { "accession": "Q9Y624", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/Q9Y624", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-Q9Y624-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-Q9Y624-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/Q9Y624", "mean_plddt": 87.2, "plddt_band": "Confident (70–90)", "n_residues": 299, "local_pdb": "digital_twin\\data\\structures\\Q9Y624_AF.pdb" }, "uniprot": "Q9Y624", "uniprot_name": "Junctional adhesion molecule A", "length": 299, "function": "Seems to play a role in epithelial tight junction formation. Appears early in primordial forms of cell junctions and recruits PARD3 (PubMed:11489913). The association of the PARD6-PARD3 complex may prevent the interaction of PARD3 with JAM1, thereby preventing tight junction assembly (By similarity). Plays a role in regulating monocyte transmigration involved in integrity of epithelial barrier (By similarity). Ligand for integrin alpha-L/beta-2 involved in memory T-cell and neutrophil transmigration (PubMed:11812992). Involved in platelet activation (PubMed:10753840)", "pdb_count": 4, "pdb_ids": [ "1NBQ", "3EOY", "3TSZ", "4ODB" ], "grounding": [], "grounded_in_corpus": false }, { "gene": "F2R", "name": "Coagulation factor II thrombin receptor (PAR1)", "diseases": [ "AA" ], "pathway": "protease-activated receptor signaling in dermal papilla", "twin_node": "—", "effect": "?", "role": "modulator", "drugs": [], "mechanism": "scRNA-seq ligand-receptor mapping flagged PAR1 (F2R) on dermal papilla cells as the receptor for immune-cell-derived granzyme A, a novel mechanosensory/protease axis linking the cytotoxic infiltrate to dermal papilla dysfunction.", "evidence_paper_ids": [], "n_evidence": 0, "mention_count": 0, "sources": [ "discover:recent2024_gwas_trials" ], "in_model": false, "uncertain": false, "structure": { "accession": "P25116", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/P25116", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-P25116-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-P25116-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/P25116", "mean_plddt": 74.6, "plddt_band": "Confident (70–90)", "n_residues": 425, "local_pdb": "digital_twin\\data\\structures\\P25116_AF.pdb" }, "uniprot": "P25116", "uniprot_name": "Proteinase-activated receptor 1", "length": 425, "function": "High affinity receptor that binds the activated thrombin, leading to calcium release from intracellular stores (PubMed:1672265, PubMed:8136362). The thrombin-activated receptor signaling pathway is mediated through PTX-insensitive G proteins, activation of phospholipase C resulting in the production of 1D-myo-inositol 1,4,5-trisphosphate (InsP3) which binds to InsP3 receptors causing calcium release from the stores (By similarity). In astrocytes, the calcium released into the cytosol allows the Ca(2+)-dependent release of L-glutamate into the synaptic cleft through BEST1, that targets the neur", "pdb_count": 13, "pdb_ids": [ "1NRN", "1NRO", "1NRP", "1NRQ", "1NRR", "3BEF", "3HKI", "3HKJ" ], "grounding": [], "grounded_in_corpus": false }, { "gene": "FOXN1", "name": "Forkhead box protein N1", "diseases": [ "CIA" ], "pathway": "Transcription factor", "twin_node": "—", "effect": "?", "role": "modulator", "drugs": [], "mechanism": "Master transcription factor of follicular keratinocyte differentiation controlling hair-keratin expression; its loss (nude phenotype) yields structurally defective hairless shafts.", "evidence_paper_ids": [], "n_evidence": 0, "mention_count": 0, "sources": [ "discover:CIA" ], "in_model": false, "uncertain": false, "structure": { "accession": "O15353", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/O15353", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-O15353-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-O15353-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/O15353", "mean_plddt": 53.7, "plddt_band": "Low (50–70)", "n_residues": 648, "local_pdb": "digital_twin\\data\\structures\\O15353_AF.pdb" }, "uniprot": "O15353", "uniprot_name": "Forkhead box protein N1", "length": 648, "function": "Transcriptional regulator which regulates the development, differentiation, and function of thymic epithelial cells (TECs) both in the prenatal and postnatal thymus. Acts as a master regulator of the TECs lineage development and is required from the onset of differentiation in progenitor TECs in the developing fetus to the final differentiation steps through which TECs mature to acquire their full functionality. Regulates, either directly or indirectly the expression of a variety of genes that mediate diverse aspects of thymus development and function, including MHC Class II, DLL4, CCL25, CTSL", "pdb_count": 2, "pdb_ids": [ "5OCN", "6EL8" ], "grounding": [ { "paper": "‘Cyclic alopecia’ in Msx2 mutants defects in hair cycling and hair shaft differentiation", "quote": "cycle, Msx2 deficiency shortens anagen phase, but prolongs catagen and telogen. Msx2-deficient hair shafts are structurally abnormal. Molecular analyses suggest a Bmp4/Bmp2/Msx2/Foxn1 acidic hair keratin pathway is involved. These structurally abnormal hairs are easily dislodged in catagen implying ", "n_hits": 33 }, { "paper": "Alopecia in a Viable Phospholipase C Delta 1 and Phospholipase C Delta 3 Double Mutant", "quote": "rtap9-1) [59– 63]. Three important transcription factors involved in the transcription of hair keratin and keratin associated protein encoding genes in mice and humans [51,64–74], Foxn1, Msx2 and Hoxc13, showed unaltered expression between wild-type and oltSH and oltNH mutants. The expression levels", "n_hits": 10 }, { "paper": "Secretory phospholipase A2-IIA overexpressing mice exhibit cyclic alopecia mediated through aberrant hair shaft differentiation and impaired wound healing response", "quote": "IfIC RepOrTS | 7:11619 | DOI:10.1038/s41598-017-11830-9 molecules or is there an unexplored novel mechanism. The expression levels of known genes such as Sox21, Msx2, Zdhcc13 and Foxn1 were analysed. Real time PCR data showed significant downregulation of Sox21, Msx2 and Foxn1 mRNA expression as com", "n_hits": 5 }, { "paper": "Overexpression of MYB in the skin induces alopecia and epidermal hyperplasia", "quote": "ce3) or hornerin (Hrnr) (Fig. 5a and Table S2). Interestingly, multiple genes, including transcription factors, that control hair follicle differentiation (e.g. Msx2, Bmp2, Bmp4, Foxn1, Efl5, Hoxc13 and Lhx2) were found downregulated in the skin of K5-Myb mice (Figs. 5a and Table S2). Quantitative R", "n_hits": 3 } ], "grounded_in_corpus": true }, { "gene": "GSDMD", "name": "Gasdermin D", "diseases": [ "AA" ], "pathway": "Inflammasome/pyroptosis", "twin_node": "INF", "effect": "+", "role": "driver", "drugs": [ "disulfiram (GSDMD inhibitor, investigational)" ], "mechanism": "Caspase-1-cleaved pore-forming executioner of pyroptosis that releases IL-1 family cytokines and DAMPs, propagating perifollicular inflammation in AA.", "evidence_paper_ids": [], "n_evidence": 0, "mention_count": 0, "sources": [ "discover:AA" ], "in_model": false, "uncertain": false, "structure": { "accession": "P57764", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/P57764", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-P57764-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-P57764-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/P57764", "mean_plddt": 77.8, "plddt_band": "Confident (70–90)", "n_residues": 484, "local_pdb": "digital_twin\\data\\structures\\P57764_AF.pdb" }, "uniprot": "P57764", "uniprot_name": "Gasdermin-D", "length": 484, "function": "Precursor of a pore-forming protein that plays a key role in host defense against pathogen infection and danger signals (PubMed:26375003, PubMed:26375259, PubMed:27281216). This form constitutes the precursor of the pore-forming protein: upon cleavage, the released N-terminal moiety (Gasdermin-D, N-terminal) binds to membranes and forms pores, triggering pyroptosis (PubMed:26375003, PubMed:26375259, PubMed:27281216)", "pdb_count": 7, "pdb_ids": [ "5NH1", "5WQT", "6AO4", "6KN0", "6N9O", "6VFE", "7Z1X" ], "grounding": [ { "paper": "Total glucosides of paeony inhibit NLRP3 caspase-1 GSDMD-mediated inflammation and pyroptosis in C3H HeJ mice with alopecia areata", "quote": "ons.org/licenses/by/4.0/). Biomolecules and Biomedicine, 2025, Vol. 25, No. 4, 954–964 954 www.biomolbiomed.com RESEARCH ARTICLE Total glucosides of paeony inhibit NLRP3/caspase-1/GSDMD-mediated inflammation and pyroptosis in C3H/HeJ mice with alopecia areata Jingfang Zhang 1,2, Zhiquan Li 3, Kunpen", "n_hits": 46 } ], "grounded_in_corpus": true }, { "gene": "GZMA", "name": "Granzyme A", "diseases": [ "AA" ], "pathway": "cytotoxic T-cell - dermal papilla crosstalk (GZMA-F2R)", "twin_node": "INF", "effect": "+", "role": "driver", "drugs": [], "mechanism": "Single-cell RNA-seq of lesional scalp identified a previously unreported GZMA ligand-receptor interaction between cytotoxic T cells and dermal papilla via F2R/PAR1, implicating extracellular granzyme A in protease-activated follicular signaling.", "evidence_paper_ids": [], "n_evidence": 0, "mention_count": 0, "sources": [ "discover:recent2024_gwas_trials" ], "in_model": false, "uncertain": false, "structure": { "accession": "P12544", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/P12544", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-P12544-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-P12544-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/P12544", "mean_plddt": 91.6, "plddt_band": "Very high (≥90)", "n_residues": 262, "local_pdb": "digital_twin\\data\\structures\\P12544_AF.pdb" }, "uniprot": "P12544", "uniprot_name": "Granzyme A", "length": 262, "function": "Abundant protease in the cytosolic granules of cytotoxic T-cells and NK-cells which activates caspase-independent pyroptosis when delivered into the target cell through the immunological synapse (PubMed:12819770, PubMed:32299851, PubMed:3257574, PubMed:3262682, PubMed:3263427). It cleaves after Lys or Arg (PubMed:12819770, PubMed:32299851). Once delivered into the target cell, acts by catalyzing cleavage of gasdermin-B (GSDMB), releasing the pore-forming moiety of GSDMB, thereby triggering pyroptosis and target cell death (PubMed:32299851, PubMed:34022140, PubMed:36157507, PubMed:36899106). Cl", "pdb_count": 2, "pdb_ids": [ "1OP8", "1ORF" ], "grounding": [ { "paper": "JAK-centric explainable few-shot gene-expression diagnosis framework for alopecia via MultiPLIER priors and relation-style set-to-set comparison.", "quote": "fied; WGCNA and consensus machine learning (LASSO, SVM-RFE, random forest) yielded six candidate hub genes, and external validation narrowed these to four key genes–granzyme A (GZMA), interleukin-2 receptor β (IL2RB) and γ (IL2RG) chains, and eomesodermin (EOMES). Building on these biology-anchored ", "n_hits": 40 }, { "paper": "Blockade of IL-7 signaling suppresses inflammatory responses and reverses alopecia areata in C3H HeJ mice", "quote": "are known to augment the cytotoxic function of CD8+ T cells by inducing the production of those cytotoxic mediators (19). We observed that IL-7 also en- hanced the production of GZMA, GZMB, and PRF-1 by CD8+ T cells (Fig. 2, C and D). Given the role of IL-7 in promoting TH1 and Tc1 responses in vitr", "n_hits": 6 }, { "paper": "Genetic analysis of a novel antioxidant multi-target iron chelator, M30 protecting against chemotherapy-induced alopecia in mice", "quote": "ormal MC/ CTX Condition 2 CTX/ Normal MC/ CTX Condition 2 CTX/ Normal MC/ CTX Condition 2 CTX/ Normal MC/ CTX Ptgis 0.141 5.335 Ptgis 0.141 5.335 Pf4 0.084 5.956 Snrpn 0.527 1.992 Gzma 0.139 8.220 Gzma 0.139 8.220 Ccr5 0.083 5.403 Rbpms 0.503 1.687 Scn2a1 0.116 5.697 Scn2a1 0.116 5.697 Ccl7 0.073 4.", "n_hits": 2 } ], "grounded_in_corpus": true }, { "gene": "GZMB", "name": "Granzyme B", "diseases": [ "AA" ], "pathway": "Cytotoxic immunity", "twin_node": "—", "effect": "?", "role": "driver", "drugs": [], "mechanism": "Cytotoxic serine protease released by activated CD8+ T cells to induce apoptosis of hair-follicle keratinocytes, an effector marker elevated in active AA lesions.", "evidence_paper_ids": [], "n_evidence": 0, "mention_count": 0, "sources": [ "discover:AA" ], "in_model": false, "uncertain": false, "structure": { "accession": "P10144", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/P10144", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-P10144-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-P10144-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/P10144", "mean_plddt": 92.4, "plddt_band": "Very high (≥90)", "n_residues": 247, "local_pdb": "digital_twin\\data\\structures\\P10144_AF.pdb" }, "uniprot": "P10144", "uniprot_name": "Granzyme B", "length": 247, "function": "Abundant protease in the cytosolic granules of cytotoxic T-cells and NK-cells which activates caspase-independent pyroptosis when delivered into the target cell through the immunological synapse (PubMed:1985927, PubMed:3262682, PubMed:3263427). It cleaves after Asp (PubMed:1985927, PubMed:8258716). Once delivered into the target cell, acts by catalyzing cleavage of gasdermin-E (GSDME), releasing the pore-forming moiety of GSDME, thereby triggering pyroptosis and target cell death (PubMed:31953257, PubMed:32188940). Seems to be linked to an activation cascade of caspases (aspartate-specific cys", "pdb_count": 2, "pdb_ids": [ "1FQ3", "1IAU" ], "grounding": [ { "paper": "Blockade of IL-7 signaling suppresses inflammatory responses and reverses alopecia areata in C3H HeJ mice", "quote": "own to augment the cytotoxic function of CD8+ T cells by inducing the production of those cytotoxic mediators (19). We observed that IL-7 also en- hanced the production of GZMA, GZMB, and PRF-1 by CD8+ T cells (Fig. 2, C and D). Given the role of IL-7 in promoting TH1 and Tc1 responses in vitro, we ", "n_hits": 8 }, { "paper": "Impaired autophagy promotes hair loss in the C3H HeJ mouse model of alopecia areata", "quote": "N of Tat-SCRAMBLE or Tat- BECN1 treated AA mice (Figure S1). We found no statistical differences in the proportion of total CD4+ or CD8A+ T cells, CD4+ FOXP3+ Tregs, or KLRK1-, GZMB- or IFNG-expressing CD8A+ T cell subsets in either the skin or in SDLN (Figure 2E). Further, we found no change in the", "n_hits": 3 }, { "paper": "Selective Janus kinase 1 inhibition resolves inflammation and restores hair growth offering a viable treatment option for alopecia areata", "quote": "and GSE94236 (mouse skin samples) (https://www.ncbi.nlm.nih.gov/geo/query/acc. cgi?acc=GSE94236). 2.4.6 | ALADIN scores IFN (Cxcl9, Cxcl10, Cxcl11, Stat1, and Mx1) and CTL (Cd8a, Gzmb, Icos, Prf1) ALADIN scores for the Taq- man data were calculated for each group as described previously.9,49 Briefly", "n_hits": 3 }, { "paper": "Selective inhibition of JAK3 signaling is sufficient to reverse alopecia areata", "quote": "ated cells from C3H/HeJ mice were then stimulated with 20 ng/mL IL-15 and 250 nM of indicated JAKi at 37°C for 72 hours. (G) Expression of NKG2D and (H) expression of Granzyme B (GZMB) and Perforin 1 (PRF1) by CD8+ T cells presented as representative plots and MFI. The data shown are from 1 represen", "n_hits": 3 } ], "grounded_in_corpus": true }, { "gene": "HCAR2", "name": "Hydroxycarboxylic acid receptor 2 / PGD2 receptor 2 (GPR44/CRTH2 axis target)", "diseases": [ "AGA" ], "pathway": "PGD2-GPR44(CRTH2/PTGDR2) inhibition of hair growth", "twin_node": "APO", "effect": "?", "role": "modulator", "drugs": [ "fevipiprant", "ramatroban", "setipiprant (Phase 2, AGA)" ], "mechanism": "Prostaglandin D2 (via PTGS2/lipocalin-PGDS) accumulates in balding scalp and signals through GPR44 (PTGDR2/CRTH2) to suppress hair growth and lengthen telogen. GPR44 antagonists (e.g., setipiprant/fevipiprant repurposing) aim to relieve this PGD2-mediated brake. Note: target receptor is PTGDR2; HCAR2 listed where omitted - primary druggable node is PTGDR2.", "evidence_paper_ids": [], "n_evidence": 0, "mention_count": 0, "sources": [ "discover:recent" ], "in_model": false, "uncertain": true, "structure": { "accession": "Q8TDS4", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/Q8TDS4", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-Q8TDS4-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-Q8TDS4-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/Q8TDS4", "mean_plddt": 82.7, "plddt_band": "Confident (70–90)", "n_residues": 363, "local_pdb": "digital_twin\\data\\structures\\Q8TDS4_AF.pdb" }, "uniprot": "Q8TDS4", "uniprot_name": "Hydroxycarboxylic acid receptor 2", "length": 363, "function": "Acts as a high affinity receptor for both nicotinic acid (also known as niacin) and (D)-beta-hydroxybutyrate and mediates increased adiponectin secretion and decreased lipolysis through G(i)-protein-mediated inhibition of adenylyl cyclase. This pharmacological effect requires nicotinic acid doses that are much higher than those provided by a normal diet. Mediates nicotinic acid-induced apoptosis in mature neutrophils. Receptor activation by nicotinic acid results in reduced cAMP levels which may affect activity of cAMP-dependent protein kinase A and phosphorylation of target proteins, leading ", "pdb_count": 37, "pdb_ids": [ "7XK2", "7ZL9", "7ZLY", "8H2G", "8I7V", "8I7W", "8IHB", "8IHF" ], "grounding": [], "grounded_in_corpus": false }, { "gene": "HLA-B", "name": "Major histocompatibility complex class I B (HLA-B*07:02)", "diseases": [ "CIA" ], "pathway": "MHC class I antigen presentation (6p21 locus)", "twin_node": "INF", "effect": "+", "role": "driver", "drugs": [], "mechanism": "Fine-mapping identifies HLA-B*07:02 as the strongest FFA risk allele; aberrant class I antigen presentation drives cytotoxic CD8+ T-cell attack on the follicular bulge, distinguishing FFA's lichenoid scarring mechanism.", "evidence_paper_ids": [], "n_evidence": 0, "mention_count": 0, "sources": [ "discover:recent2024_gwas_trials" ], "in_model": false, "uncertain": false, "structure": { "accession": "P01889", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/P01889", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-P01889-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-P01889-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/P01889", "mean_plddt": 88.1, "plddt_band": "Confident (70–90)", "n_residues": 362, "local_pdb": "digital_twin\\data\\structures\\P01889_AF.pdb" }, "uniprot": "P01889", "uniprot_name": "HLA class I histocompatibility antigen, B alpha chain", "length": 362, "function": "Antigen-presenting major histocompatibility complex class I (MHCI) molecule. In complex with B2M/beta 2 microglobulin displays primarily viral and tumor-derived peptides on antigen-presenting cells for recognition by alpha-beta T cell receptor (TCR) on HLA-B-restricted CD8-positive T cells, guiding antigen-specific T cell immune response to eliminate infected or transformed cells (PubMed:23209413, PubMed:25808313, PubMed:29531227, PubMed:9620674). May also present self-peptides derived from the signal sequence of secreted or membrane proteins, although T cells specific for these peptides are u", "pdb_count": 233, "pdb_ids": [ "1A1M", "1A1N", "1A1O", "1A9B", "1A9E", "1AGB", "1AGC", "1AGD" ], "grounding": [], "grounded_in_corpus": false }, { "gene": "IFNGR1", "name": "Interferon gamma receptor 1", "diseases": [ "AA" ], "pathway": "Type II interferon", "twin_node": "INF", "effect": "+", "role": "driver", "drugs": [], "mechanism": "Ligand-binding chain of the IFN-gamma receptor on follicular keratinocytes that triggers JAK1/JAK2-STAT1 signaling to initiate immune-privilege collapse in AA.", "evidence_paper_ids": [], "n_evidence": 0, "mention_count": 0, "sources": [ "discover:AA" ], "in_model": false, "uncertain": false, "structure": { "accession": "P15260", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/P15260", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-P15260-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-P15260-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/P15260", "mean_plddt": 66.0, "plddt_band": "Low (50–70)", "n_residues": 489, "local_pdb": "digital_twin\\data\\structures\\P15260_AF.pdb" }, "uniprot": "P15260", "uniprot_name": "Interferon gamma receptor 1", "length": 489, "function": "Receptor subunit for interferon gamma/INFG that plays crucial roles in antimicrobial, antiviral, and antitumor responses by activating effector immune cells and enhancing antigen presentation (PubMed:20015550). Associates with transmembrane accessory factor IFNGR2 to form a functional receptor (PubMed:10986460, PubMed:2971451, PubMed:7615558, PubMed:7617032, PubMed:7673114). Upon ligand binding, the intracellular domain of IFNGR1 opens out to allow association of downstream signaling components JAK1 and JAK2. In turn, activated JAK1 phosphorylates IFNGR1 to form a docking site for STAT1. Subse", "pdb_count": 5, "pdb_ids": [ "1FG9", "1FYH", "1JRH", "6E3K", "6E3L" ], "grounding": [ { "paper": "JAK-STAT1 as therapeutic target for EGFR deficiency-associated inflammation and scarring alopecia", "quote": "4 Tap1 Tap2 Tapbp Nlrc5 Nlrc3 Antigen presentation WT Psmb10 Psmb8 Psmb9 Rpn1 Rpn2 Hspd1 Hspe1 Immunoproteasome -1 0 1 Osmr Il10rb Il11ra1 Il11ra2 Il13ra1 Il20rb Il4ra Il6ra Il6st Ifngr1 Ifngr2 Ifnar1 Ifnar2 Jak1 Jak2 Jak3 Tyk2 Stat1 Stat3 Stat4 Stat5a Stat5b Ifi214 Ifi47 Ifitm3 Socs3 JAK-STAT Pathw", "n_hits": 3 } ], "grounded_in_corpus": true }, { "gene": "IKZF4", "name": "IKAROS family zinc finger 4 (Eos)", "diseases": [ "AA" ], "pathway": "FOXP3 transcriptional program / Treg stability", "twin_node": "—", "effect": "?", "role": "modulator", "drugs": [], "mechanism": "AA risk locus at 12q13.2 (IKZF4/ERBB3); Eos is a FOXP3 corepressor essential for regulatory T-cell identity, so reduced function destabilizes Tregs and permits autoimmune hair loss.", "evidence_paper_ids": [], "n_evidence": 0, "mention_count": 0, "sources": [ "discover:recent2024_gwas_trials" ], "in_model": false, "uncertain": false, "structure": { "accession": "Q9H2S9", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/Q9H2S9", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-Q9H2S9-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-Q9H2S9-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/Q9H2S9", "mean_plddt": 49.0, "plddt_band": "Very low (<50)", "n_residues": 585, "local_pdb": "digital_twin\\data\\structures\\Q9H2S9_AF.pdb" }, "uniprot": "Q9H2S9", "uniprot_name": "Zinc finger protein Eos", "length": 585, "function": "DNA-binding protein that binds to the 5'GGGAATRCC-3' Ikaros-binding sequence. Transcriptional repressor. Interacts with SPI1 and MITF to repress transcription of the CTSK and ACP5 promoters via recruitment of corepressors SIN3A and CTBP2. May be involved in the development of central and peripheral nervous systems. Essential for the inhibitory function of regulatory T-cells (Treg). Mediates FOXP3-mediated gene silencing in regulatory T-cells (Treg) via recruitment of corepressor CTBP1 (By similarity)", "pdb_count": 1, "pdb_ids": [ "2MA7" ], "grounding": [], "grounded_in_corpus": false }, { "gene": "IL15RA", "name": "Interleukin-15 receptor subunit alpha", "diseases": [ "AA" ], "pathway": "Cytokine (common gamma chain)", "twin_node": "INF", "effect": "+", "role": "driver", "drugs": [], "mechanism": "Binds IL-15 with high affinity on keratinocytes/antigen-presenting cells to enable trans-presentation that activates autoreactive cytotoxic T cells in the AA follicle.", "evidence_paper_ids": [], "n_evidence": 0, "mention_count": 0, "sources": [ "discover:AA" ], "in_model": false, "uncertain": false, "structure": { "accession": "Q13261", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/Q13261", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-Q13261-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-Q13261-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/Q13261", "mean_plddt": 64.5, "plddt_band": "Low (50–70)", "n_residues": 267, "local_pdb": "digital_twin\\data\\structures\\Q13261_AF.pdb" }, "uniprot": "Q13261", "uniprot_name": "Interleukin-15 receptor subunit alpha", "length": 267, "function": "High-affinity receptor for interleukin-15 (PubMed:8530383). Can signal both in cis and trans where IL15R from one subset of cells presents IL15 to neighboring IL2RG-expressing cells (By similarity). In neutrophils, binds and activates kinase SYK in response to IL15 stimulation (PubMed:15123770). In neutrophils, required for IL15-induced phagocytosis in a SYK-dependent manner (PubMed:15123770). Expression of different isoforms may alter or interfere with signal transduction (PubMed:10480910)", "pdb_count": 4, "pdb_ids": [ "2ERS", "2Z3Q", "2Z3R", "4GS7" ], "grounding": [], "grounded_in_corpus": false }, { "gene": "IL2", "name": "Interleukin-2", "diseases": [ "AA" ], "pathway": "Cytokine (common gamma chain)", "twin_node": "INF", "effect": "?", "role": "modulator", "drugs": [ "low-dose IL-2 / aldesleukin (investigational)" ], "mechanism": "Dual-natured cytokine that expands effector T cells but at low dose preferentially supports regulatory T cells, the basis for low-dose IL-2 immunotherapy being explored to restore tolerance in AA.", "evidence_paper_ids": [], "n_evidence": 0, "mention_count": 0, "sources": [ "discover:AA" ], "in_model": false, "uncertain": false, "structure": { "accession": "P60568", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/P60568", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-P60568-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-P60568-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/P60568", "mean_plddt": 84.1, "plddt_band": "Confident (70–90)", "n_residues": 153, "local_pdb": "digital_twin\\data\\structures\\P60568_AF.pdb" }, "uniprot": "P60568", "uniprot_name": "Interleukin-2", "length": 153, "function": "Cytokine produced by activated CD4-positive helper T-cells and to a lesser extend activated CD8-positive T-cells and natural killer (NK) cells that plays pivotal roles in the immune response and tolerance (PubMed:6438535). Binds to a receptor complex composed of either the high-affinity trimeric IL-2R (IL2RA/CD25, IL2RB/CD122 and IL2RG/CD132) or the low-affinity dimeric IL-2R (IL2RB and IL2RG) (PubMed:16293754, PubMed:16477002). Interaction with the receptor leads to oligomerization and conformation changes in the IL-2R subunits resulting in downstream signaling starting with phosphorylation o", "pdb_count": 36, "pdb_ids": [ "1IRL", "1M47", "1M48", "1M49", "1M4A", "1M4B", "1M4C", "1NBP" ], "grounding": [ { "paper": "Immunoregulatory Effects of Myeloid-Derived Suppressor Cell Exosomes in Mouse Model of Autoimmune Alopecia Areata", "quote": "were seeded in U-shaped 96-well plate (1 × 105–2.5 × 104 cells/well) in the absence or presence of MDSC at the indicated ratios or MDSC-Exo (20 µg/ml). Cells were stimulated by IL2 (100 U/ml) or 1 × 104 DC loaded with keratin peptides (DC-AApept)/well. Cells were cultured for 3 days adding 3H-thymid", "n_hits": 23 }, { "paper": "A mouse model of clonal CD8+ T lymphocyte-mediated alopecia areata progressing to alopecia universalis", "quote": "analyzed in triplicate. Cytokine analysis Primary CD8+ T cells (5 × 104) were isolated and stimulated as above. Culture supernatants were collected at 24 or 48 h and analyzed for IL2, IL4, IL10, IFNG, and IL17 by Bio-Plex assay (Bio-Rad). Real time PCR Skin specimens were taken from 1MOG244.1 mice w", "n_hits": 5 }, { "paper": "Effects of Baicalin on Alopecia and the Associated Mechanism", "quote": "5 ITK CTSG TYMS CTSD SOD2 CA2TGM2RNASE3 SHBG PIK3CG C1S C1R RAC2 HADH SHMT1 F10 SNRPA PPARA GC TPH1 RXRA CASP7 CFD AHCY DCK XIAP CHIT1 NR1H2 MMP13 MMP1 APCS TYMP CMA1 KDR LCK MDM2 IL2 SYK PGR ESR2 SRC HSP90AA1 PTPN11 AKT1 ESR1 TTR FGFR2 DHODH STS DHFR OTC LTA4H PLK1 CFB NMNAT1 CYP19A1 THRB IGF1R PTP", "n_hits": 2 } ], "grounded_in_corpus": true }, { "gene": "IL21", "name": "Interleukin 21", "diseases": [ "AA" ], "pathway": "Tfh/Th17 cytokine signaling (IL2/IL21 locus)", "twin_node": "INF", "effect": "+", "role": "driver", "drugs": [], "mechanism": "Encoded at the 4q27 IL2/IL21 AA-susceptibility locus; IL-21 amplifies follicular helper and cytotoxic T-cell responses and STAT3 activation, sustaining the autoimmune infiltrate around the follicle.", "evidence_paper_ids": [], "n_evidence": 0, "mention_count": 0, "sources": [ "discover:recent2024_gwas_trials" ], "in_model": false, "uncertain": false, "structure": { "accession": "Q9HBE4", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/Q9HBE4", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-Q9HBE4-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-Q9HBE4-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/Q9HBE4", "mean_plddt": 83.4, "plddt_band": "Confident (70–90)", "n_residues": 162, "local_pdb": "digital_twin\\data\\structures\\Q9HBE4_AF.pdb" }, "uniprot": "Q9HBE4", "uniprot_name": "Interleukin-21", "length": 162, "function": "Cytokine with immunoregulatory activity. May promote the transition between innate and adaptive immunity. Induces the production of IgG(1) and IgG(3) in B-cells (By similarity). Implicated in the generation and maintenance of T follicular helper (Tfh) cells and the formation of germinal-centers. Together with IL6, control the early generation of Tfh cells and are critical for an effective antibody response to acute viral infection (By similarity). May play a role in proliferation and maturation of natural killer (NK) cells in synergy with IL15. May regulate proliferation of mature B- and T-cel", "pdb_count": 3, "pdb_ids": [ "2OQP", "3TGX", "8ENT" ], "grounding": [], "grounded_in_corpus": false }, { "gene": "IL2RB", "name": "Interleukin-2 receptor subunit beta (regulatory-T-cell-directed IL-2 target)", "diseases": [ "AA" ], "pathway": "Low-dose/PEG-IL-2 -> Treg expansion (tolerance restoration)", "twin_node": "INF", "effect": "-", "role": "protector", "drugs": [ "rezpegaldesleukin (Nektar NKTR-358, Phase 2, Fast Track)" ], "mechanism": "Rather than suppressing effectors, a PEGylated IL-2 (rezpegaldesleukin) preferentially expands regulatory T cells via IL-2Rbeta/gamma to restore follicular immune tolerance in AA; granted FDA Fast Track for severe AA. Represents a tolerogenic, Treg-restoring target distinct from JAK/cytokine blockade.", "evidence_paper_ids": [], "n_evidence": 0, "mention_count": 0, "sources": [ "discover:recent" ], "in_model": false, "uncertain": false, "structure": { "accession": "P14784", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/P14784", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-P14784-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-P14784-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/P14784", "mean_plddt": 64.6, "plddt_band": "Low (50–70)", "n_residues": 551, "local_pdb": "digital_twin\\data\\structures\\P14784_AF.pdb" }, "uniprot": "P14784", "uniprot_name": "Interleukin-2 receptor subunit beta", "length": 551, "function": "Receptor for interleukin-2. This beta subunit is involved in receptor mediated endocytosis and transduces the mitogenic signals of IL2. Probably in association with IL15RA, involved in the stimulation of neutrophil phagocytosis by IL15 (PubMed:15123770, PubMed:31040185)", "pdb_count": 7, "pdb_ids": [ "2B5I", "2ERJ", "3QAZ", "4GS7", "5M5E", "6E8K", "7S2S" ], "grounding": [ { "paper": "JAK-centric explainable few-shot gene-expression diagnosis framework for alopecia via MultiPLIER priors and relation-style set-to-set comparison.", "quote": "e learning (LASSO, SVM-RFE, random forest) yielded six candidate hub genes, and external validation narrowed these to four key genes–granzyme A (GZMA), interleukin-2 receptor β (IL2RB) and γ (IL2RG) chains, and eomesodermin (EOMES). Building on these biology-anchored features, we introduced an inter", "n_hits": 36 } ], "grounded_in_corpus": true }, { "gene": "IL2RG", "name": "Interleukin-2 receptor subunit gamma (common gamma chain)", "diseases": [ "AA" ], "pathway": "Cytokine (common gamma chain)", "twin_node": "INF", "effect": "+", "role": "driver", "drugs": [ "ritlecitinib (via JAK3)" ], "mechanism": "Shared signaling chain for IL-15, IL-2 and IL-7 receptors that couples to JAK3; its blockade (via JAK3 inhibition) shuts off the cytotoxic-cytokine axis driving AA.", "evidence_paper_ids": [], "n_evidence": 0, "mention_count": 0, "sources": [ "discover:AA" ], "in_model": false, "uncertain": false, "structure": { "accession": "P31785", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/P31785", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-P31785-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-P31785-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/P31785", "mean_plddt": 75.5, "plddt_band": "Confident (70–90)", "n_residues": 369, "local_pdb": "digital_twin\\data\\structures\\P31785_AF.pdb" }, "uniprot": "P31785", "uniprot_name": "Cytokine receptor common subunit gamma", "length": 369, "function": "Common subunit for the receptors for a variety of interleukins. Probably in association with IL15RA, involved in the stimulation of neutrophil phagocytosis by IL15 (PubMed:15123770)", "pdb_count": 12, "pdb_ids": [ "2B5I", "2ERJ", "3BPL", "3QAZ", "3QB7", "4GS7", "5M5E", "6OEL" ], "grounding": [ { "paper": "JAK-centric explainable few-shot gene-expression diagnosis framework for alopecia via MultiPLIER priors and relation-style set-to-set comparison.", "quote": "SSO, SVM-RFE, random forest) yielded six candidate hub genes, and external validation narrowed these to four key genes–granzyme A (GZMA), interleukin-2 receptor β (IL2RB) and γ (IL2RG) chains, and eomesodermin (EOMES). Building on these biology-anchored features, we introduced an interpretable few-s", "n_hits": 37 } ], "grounded_in_corpus": true }, { "gene": "IL7", "name": "Interleukin-7", "diseases": [ "AA" ], "pathway": "Cytokine (common gamma chain)", "twin_node": "INF", "effect": "?", "role": "modulator", "drugs": [], "mechanism": "Supports homeostatic survival and memory of autoreactive T cells via IL7R/IL2RG-JAK signaling, contributing to disease persistence and relapse in AA.", "evidence_paper_ids": [], "n_evidence": 0, "mention_count": 0, "sources": [ "discover:AA" ], "in_model": false, "uncertain": false, "structure": { "accession": "P13232", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/P13232", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-P13232-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-P13232-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/P13232", "mean_plddt": 73.9, "plddt_band": "Confident (70–90)", "n_residues": 177, "local_pdb": "digital_twin\\data\\structures\\P13232_AF.pdb" }, "uniprot": "P13232", "uniprot_name": "Interleukin-7", "length": 177, "function": "Hematopoietic cytokine that plays an essential role in the development, expansion, and survival of naive and memory T-cells and B-cells thereby regulating the number of mature lymphocytes and maintaining lymphoid homeostasis (PubMed:25870237, PubMed:7527823). Mechanistically, exerts its biological effects through a receptor composed of IL7RA subunit and the cytokine receptor common subunit gamma/CSF2RG (PubMed:8128231). Binding to the receptor leads to activation of various kinases including JAK1 or JAK3 depending on the cell type and subsequently propagation of signals through activation of s", "pdb_count": 2, "pdb_ids": [ "3DI2", "3DI3" ], "grounding": [], "grounded_in_corpus": false }, { "gene": "IL9", "name": "Interleukin 9", "diseases": [ "AA" ], "pathway": "Th9 / mast-cell cytokine signaling (gamma-chain)", "twin_node": "INF", "effect": "+", "role": "driver", "drugs": [], "mechanism": "Clinical-trial target: EQ101 is a first-in-class tri-specific inhibitor of IL-2, IL-9 and IL-15 in Phase 2 for moderate-to-severe AA; IL-9 promotes mast-cell and T-cell mediated inflammation distinct from the JAK-dependent axis.", "evidence_paper_ids": [], "n_evidence": 0, "mention_count": 0, "sources": [ "discover:recent2024_gwas_trials" ], "in_model": false, "uncertain": false, "structure": { "accession": "P15248", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/P15248", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-P15248-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-P15248-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/P15248", "mean_plddt": 84.1, "plddt_band": "Confident (70–90)", "n_residues": 144, "local_pdb": "digital_twin\\data\\structures\\P15248_AF.pdb" }, "uniprot": "P15248", "uniprot_name": "Interleukin-9", "length": 144, "function": "Multifunctional cytokine secreted mainly by T-helper 2 lymphocytes and also mast cells or NKT cells that plays important roles in the immune response against parasites (PubMed:29742432). Affects intestinal epithelial permeability and adaptive immunity (PubMed:29742432). In addition, induces the differentiation of specific T-cell subsets such as IL-17 producing helper T-cells (TH17) and also proliferation and differentiation of mast cells. Mechanistically, exerts its biological effects through a receptor composed of IL9R subunit and a signal transducing subunit IL2RG. Receptor stimulation resul", "pdb_count": 5, "pdb_ids": [ "7OX1", "7OX2", "7OX3", "7OX5", "7OX6" ], "grounding": [], "grounded_in_corpus": false }, { "gene": "KRT15", "name": "Keratin, type I cytoskeletal 15", "diseases": [ "AGA" ], "pathway": "Bulge HFSC intermediate-filament marker", "twin_node": "HFSC", "effect": "?", "role": "modulator", "drugs": [], "mechanism": "Cytokeratin enriched in quiescent bulge stem cells that serves as a canonical human HFSC marker and structural component of the niche cytoskeleton.", "evidence_paper_ids": [], "n_evidence": 0, "mention_count": 0, "sources": [ "discover:HFSC" ], "in_model": false, "uncertain": false, "structure": { "accession": "P19012", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/P19012", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-P19012-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-P19012-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/P19012", "mean_plddt": 74.2, "plddt_band": "Confident (70–90)", "n_residues": 456, "local_pdb": "digital_twin\\data\\structures\\P19012_AF.pdb" }, "uniprot": "P19012", "uniprot_name": "Keratin, type I cytoskeletal 15", "length": 456, "function": "", "pdb_count": 0, "pdb_ids": [], "grounding": [ { "paper": "Deletion of hypoxia-inducible factor prolyl 4-hydroxylase 2 in FoxD1-lineage mesenchymal cells leads to congenital truncal alopecia", "quote": "2.0 3.0 4.0 5.0 6.0 A Control cKO Keratin 1 Keratin 5 Loricrin C Relative Krt5 mRNA * Relative Krt1 mRNA ** * Relative Krt10 mRNA ** * Relative Lor mRNA Relative Kgf mRNA Relative Krt15 mRNA Control cKO Skin overview Hair follicle Skin surface Hair shaft B Relative Krt14 mRNA *** ** ** *** ** *** **", "n_hits": 15 }, { "paper": "JAK-STAT1 as therapeutic target for EGFR deficiency-associated inflammation and scarring alopecia", "quote": "kin sections and epidermal whole mounts of older mice (5–7 M) indicated the complete degradation of the hair follicle structure together with the stem cell markers CD34, Sox9, and Krt15 (Figs. 1I and EV1F). These data demonstrate that hair follicle-specific EGFR protects from microbiota-driven inflamm", "n_hits": 6 }, { "paper": "Prostaglandin D2 Inhibits Hair Growth and Is Elevated in Bald Scalp of Men with Androgenetic Alopecia", "quote": "r Manuscript NIH-PA Author Manuscript To corroborate this pattern seen by immunohistochemistry, we next examined double immunofluorescence labeling for both Ptgds and keratin 15 (Krt15), a hair follicle stem cell marker (22). At day 0 of depilation (telogen), Krt15 was present in the bulge area at t", "n_hits": 6 }, { "paper": "Overexpression of MYB in the skin induces alopecia and epidermal hyperplasia", "quote": "luorescence for the indicated hair follicles markers, in hair follicles from control and K5-Myb mice, at P35 and P90, as indicated. Scale bar= 50μm. (b) Immunohistochemistry for KRT15 and quantification of the number of KRT15 positive cells per hair follicle (HF) at P45 (n=3). Scale bar= 100μm. (c) ", "n_hits": 2 } ], "grounded_in_corpus": true }, { "gene": "KRT75", "name": "Keratin, type II cytoskeletal 75", "diseases": [ "CIA" ], "pathway": "Keratin/structural", "twin_node": "DP", "effect": "?", "role": "modulator", "drugs": [], "mechanism": "Companion-layer/hair-shaft keratin important for shaft integrity; its disruption contributes to weakened, breakage-prone fibers seen in chemotherapy-damaged follicles.", "evidence_paper_ids": [], "n_evidence": 0, "mention_count": 0, "sources": [ "discover:CIA" ], "in_model": false, "uncertain": false, "structure": { "accession": "O95678", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/O95678", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-O95678-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-O95678-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/O95678", "mean_plddt": 67.3, "plddt_band": "Low (50–70)", "n_residues": 551, "local_pdb": "digital_twin\\data\\structures\\O95678_AF.pdb" }, "uniprot": "O95678", "uniprot_name": "Keratin, type II cytoskeletal 75", "length": 551, "function": "Plays a central role in hair and nail formation. Essential component of keratin intermediate filaments in the companion layer of the hair follicle", "pdb_count": 0, "pdb_ids": [], "grounding": [ { "paper": "Overexpression of MYB in the skin induces alopecia and epidermal hyperplasia", "quote": "ion and differentiation in the epidermis of K5-Myb mice. Hair follicle differentiation markers were analyzed by immunofluorescence (Fig. 4a). The ORS (KRT14) and companion layer (KRT75) of K5-Myb were relatively normal at both P35 and P90, except that the companion layer was more curvy in P90 K5-Myb", "n_hits": 2 } ], "grounded_in_corpus": true }, { "gene": "LDHA", "name": "L-lactate dehydrogenase A chain", "diseases": [ "AGA" ], "pathway": "Glycolytic lactate metabolism", "twin_node": "—", "effect": "?", "role": "driver", "drugs": [ "FX11 (experimental)", "Oxamate (experimental)" ], "mechanism": "Catalyzes pyruvate-to-lactate conversion that is essential for hair-follicle stem-cell activation, and its loss prevents stem-cell proliferation and anagen entry.", "evidence_paper_ids": [], "n_evidence": 0, "mention_count": 0, "sources": [ "discover:HFSC" ], "in_model": false, "uncertain": false, "structure": { "accession": "P00338", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/P00338", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-P00338-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-P00338-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/P00338", "mean_plddt": 96.2, "plddt_band": "Very high (≥90)", "n_residues": 332, "local_pdb": "digital_twin\\data\\structures\\P00338_AF.pdb" }, "uniprot": "P00338", "uniprot_name": "L-lactate dehydrogenase A chain", "length": 332, "function": "Interconverts simultaneously and stereospecifically pyruvate and lactate with concomitant interconversion of NADH and NAD(+)", "pdb_count": 46, "pdb_ids": [ "1I10", "4AJP", "4JNK", "4L4R", "4L4S", "4M49", "4OJN", "4OKN" ], "grounding": [], "grounded_in_corpus": false }, { "gene": "LGR6", "name": "Leucine-rich repeat-containing G-protein coupled receptor 6", "diseases": [ "AGA" ], "pathway": "WNT/R-spondin potentiation", "twin_node": "Wnt", "effect": "+", "role": "protector", "drugs": [], "mechanism": "Marks isthmus/sebaceous-gland multipotent stem cells above the bulge and enhances WNT-driven epidermal and follicular lineage output.", "evidence_paper_ids": [], "n_evidence": 0, "mention_count": 0, "sources": [ "discover:HFSC" ], "in_model": false, "uncertain": false, "structure": { "accession": "Q9HBX8", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/Q9HBX8", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-Q9HBX8-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-Q9HBX8-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/Q9HBX8", "mean_plddt": 77.4, "plddt_band": "Confident (70–90)", "n_residues": 967, "local_pdb": "digital_twin\\data\\structures\\Q9HBX8_AF.pdb" }, "uniprot": "Q9HBX8", "uniprot_name": "Leucine-rich repeat-containing G-protein coupled receptor 6", "length": 967, "function": "Receptor for R-spondins that potentiates the canonical Wnt signaling pathway and acts as a marker of multipotent stem cells in the epidermis. Upon binding to R-spondins (RSPO1, RSPO2, RSPO3 or RSPO4), associates with phosphorylated LRP6 and frizzled receptors that are activated by extracellular Wnt receptors, triggering the canonical Wnt signaling pathway to increase expression of target genes. In contrast to classical G-protein coupled receptors, does not activate heterotrimeric G-proteins to transduce the signal. May act as a tumor suppressor", "pdb_count": 0, "pdb_ids": [], "grounding": [ { "paper": "Pilose antler extracts promotes hair growth in androgenetic alopecia mice by activating hair follicle stem cells via the AKT and Wnt pathways", "quote": "G c-Jun F CTTCTACGACGATGCCCTCAACG R GCCAGGTTCAAGGTCATGCTCTG Lef-1 F CACACAACTGGCATCCCTCATCC R TGGGCTCCTGCTCCTTTCTCTG Survivin F TCATCCACTGCCCTACCGAGAAC R TCCCAGCCTTCCAATTCCTTAAAGC Lgr6 F CACCTCTGGCTGGATGACAATGC Cyclind-1 R TAGTCAGGGATGTGGCGGATATGG F GGAAACGCCGACAGTGTCTTCTC R GTTGTGTTGCTGCTGTGCTTGG F", "n_hits": 5 } ], "grounded_in_corpus": true }, { "gene": "LRP5", "name": "Low-density lipoprotein receptor-related protein 5", "diseases": [ "AGA" ], "pathway": "Wnt/beta-catenin", "twin_node": "Wnt", "effect": "+", "role": "protector", "drugs": [], "mechanism": "Wnt co-receptor that, with Frizzled, transduces canonical Wnt signals into beta-catenin stabilization supporting follicle growth; antagonized by DKK1 in AGA.", "evidence_paper_ids": [], "n_evidence": 0, "mention_count": 0, "sources": [ "discover:AGA" ], "in_model": false, "uncertain": false, "structure": { "accession": "O75197", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/O75197", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-O75197-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-O75197-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/O75197", "mean_plddt": 77.9, "plddt_band": "Confident (70–90)", "n_residues": 1615, "local_pdb": "digital_twin\\data\\structures\\O75197_AF.pdb" }, "uniprot": "O75197", "uniprot_name": "Low-density lipoprotein receptor-related protein 5", "length": 1615, "function": "Acts as a coreceptor with members of the frizzled family of seven-transmembrane spanning receptors to transduce signal by Wnt proteins (PubMed:11336703, PubMed:11448771, PubMed:11719191, PubMed:15778503, PubMed:15908424, PubMed:16252235). Activates the canonical Wnt signaling pathway that controls cell fate determination and self-renewal during embryonic development and adult tissue regeneration (PubMed:11336703, PubMed:11719191). In particular, may play an important role in the development of the posterior patterning of the epiblast during gastrulation (By similarity). During bone development", "pdb_count": 0, "pdb_ids": [], "grounding": [], "grounded_in_corpus": false }, { "gene": "LRRC32", "name": "Leucine rich repeat containing 32 (GARP)", "diseases": [ "AA" ], "pathway": "TGF-beta latency / regulatory T-cell function", "twin_node": "INF", "effect": "-", "role": "modulator", "drugs": [], "mechanism": "Genome-wide significant AA locus (11q13.5); GARP docks latent TGF-beta on the Treg surface and controls its activation, so risk variants weaken Treg-mediated suppression and immune privilege of the follicle.", "evidence_paper_ids": [], "n_evidence": 0, "mention_count": 0, "sources": [ "discover:recent2024_gwas_trials" ], "in_model": false, "uncertain": false, "structure": { "accession": "Q14392", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/Q14392", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-Q14392-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-Q14392-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/Q14392", "mean_plddt": 86.1, "plddt_band": "Confident (70–90)", "n_residues": 662, "local_pdb": "digital_twin\\data\\structures\\Q14392_AF.pdb" }, "uniprot": "Q14392", "uniprot_name": "Transforming growth factor beta activator LRRC32", "length": 662, "function": "Key regulator of transforming growth factor beta (TGFB1, TGFB2 and TGFB3) that controls TGF-beta activation by maintaining it in a latent state during storage in extracellular space (PubMed:19651619, PubMed:19750484, PubMed:22278742). Associates specifically via disulfide bonds with the Latency-associated peptide (LAP), which is the regulatory chain of TGF-beta, and regulates integrin-dependent activation of TGF-beta (PubMed:22278742). Able to outcompete LTBP1 for binding to LAP regulatory chain of TGF-beta (PubMed:22278742). Controls activation of TGF-beta-1 (TGFB1) on the surface of activate", "pdb_count": 6, "pdb_ids": [ "6GFF", "8C7H", "8REW", "8VSB", "8VSC", "8VSD" ], "grounding": [], "grounded_in_corpus": false }, { "gene": "MMP9", "name": "Matrix metallopeptidase 9", "diseases": [ "CIA" ], "pathway": "extracellular matrix remodeling / fibrosis", "twin_node": "APO", "effect": "+", "role": "driver", "drugs": [], "mechanism": "Among the top genes (with SFRP4, MSR1) distinguishing severe extensive from limited CCCA; gelatinase MMP9 degrades basement membrane and remodels ECM, promoting irreversible perifollicular fibrosis in scarring alopecia.", "evidence_paper_ids": [], "n_evidence": 0, "mention_count": 0, "sources": [ "discover:recent2024_gwas_trials" ], "in_model": false, "uncertain": false, "structure": { "accession": "P14780", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/P14780", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-P14780-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-P14780-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/P14780", "mean_plddt": 82.1, "plddt_band": "Confident (70–90)", "n_residues": 707, "local_pdb": "digital_twin\\data\\structures\\P14780_AF.pdb" }, "uniprot": "P14780", "uniprot_name": "Matrix metalloproteinase-9", "length": 707, "function": "Matrix metalloproteinase that plays an essential role in local proteolysis of the extracellular matrix and in leukocyte migration (PubMed:12879005, PubMed:1480034, PubMed:2551898). Could play a role in bone osteoclastic resorption (By similarity). Cleaves KiSS1 at a Gly-|-Leu bond (PubMed:12879005). Cleaves NINJ1 to generate the Secreted ninjurin-1 form (PubMed:32883094). Cleaves type IV and type V collagen into large C-terminal three quarter fragments and shorter N-terminal one quarter fragments (PubMed:1480034). Degrades fibronectin but not laminin or Pz-peptide", "pdb_count": 29, "pdb_ids": [ "1GKC", "1GKD", "1ITV", "1L6J", "2OVX", "2OVZ", "2OW0", "2OW1" ], "grounding": [ { "paper": "ISEV2025 Abstract Book.", "quote": "ng: This research is founded by the European Council Starting Grant, project number 852152. This research is also funded by the Chinese Scholarship Council (CSC). PS2.1109 Loss of MMP9 causes cranium deformities via disturbing cranial suture fusion in mice Presenter: Jingwen Yang Wuhan University, C", "n_hits": 21 }, { "paper": "Promotion of Hair Regrowth in Androgenetic Alopecia with Supplemented Erzhi Wan Exploring Its Mechanism Using Network Pharmacology and Molecular Docking", "quote": "lin CCND1 Mohanlian MOL000006 Luteolin BCL2L1 Mohanlian MOL000006 Luteolin CDKN1A Mohanlian MOL000006 Luteolin CASP9 Mohanlian MOL000006 Luteolin MMP2 Mohanlian MOL000006 Luteolin MMP9 Mohanlian MOL000006 Luteolin MAPK1 Mohanlian MOL000006 Luteolin IL10RA Mohanlian MOL000006 Luteolin RB1 Mohanlian M", "n_hits": 4 }, { "paper": "Effects of Baicalin on Alopecia and the Associated Mechanism", "quote": "2 SYK PGR ESR2 SRC HSP90AA1 PTPN11 AKT1 ESR1 TTR FGFR2 DHODH STS DHFR OTC LTA4H PLK1 CFB NMNAT1 CYP19A1 THRB IGF1R PTPN1 JAK3 AR EGFR JAK2 PRKACA NOS3 MAPK14 CASP3 ALB CTNNA1 IGF1 MMP9 (c) KDR ELANE MDM2 IL2 JAK2 PRKACA NOS3 MAPK14 CASP3 PTPN11 AR ESR1 HSP90AA1 ALB RHOA MMP9 IGF1 EGFR SRC AKT1 12 12", "n_hits": 2 }, { "paper": "Hair Follicle Stem Cell-Specific PPARγ Deletion Causes Scarring Alopecia", "quote": "in Table 1, we observed a dramatic increase in gene expression of cytokines/chemokines (MIP1, MCP1, CCL27, MMD, IL6, RANTES), extracellular matrix- associated proteins (OPN, MMP1, MMP9, MMP10, MMP28, TIMP4, ADAMTS1), apoptosis-related genes (CASP1, GADD45B, PDCD6, PDCD4, CASP8)., and cell-surface an", "n_hits": 2 } ], "grounded_in_corpus": true }, { "gene": "MPC1", "name": "Mitochondrial pyruvate carrier 1", "diseases": [ "AGA" ], "pathway": "mitochondrial pyruvate import / glycolytic HFSC activation", "twin_node": "HFSC", "effect": "+", "role": "protector", "drugs": [], "mechanism": "Clinical-stage target (PP405, Pelage; positive Phase 2a 2025): inhibiting MPC1 forces cytosolic pyruvate into lactate via LDH, activating quiescent telogen hair-follicle stem cells to re-enter the hair cycle independent of androgen pathways.", "evidence_paper_ids": [], "n_evidence": 0, "mention_count": 0, "sources": [ "discover:recent2024_gwas_trials" ], "in_model": false, "uncertain": false, "structure": { "accession": "Q9Y5U8", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/Q9Y5U8", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-Q9Y5U8-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-Q9Y5U8-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/Q9Y5U8", "mean_plddt": 92.8, "plddt_band": "Very high (≥90)", "n_residues": 109, "local_pdb": "digital_twin\\data\\structures\\Q9Y5U8_AF.pdb" }, "uniprot": "Q9Y5U8", "uniprot_name": "Mitochondrial pyruvate carrier 1", "length": 109, "function": "Mediates the uptake of pyruvate into mitochondria to maintain the balance between glycolysis and oxidative phosphorylation (PubMed:22628558, PubMed:26253029, PubMed:27317664, PubMed:40044865, PubMed:40101766). Plays an essential role in cellular metabolism (PubMed:40044865, PubMed:40101766)", "pdb_count": 13, "pdb_ids": [ "8YW6", "8YW8", "8YW9", "9KNW", "9KNX", "9KNY", "9MNW", "9MNX" ], "grounding": [], "grounded_in_corpus": false }, { "gene": "MSR1", "name": "Macrophage scavenger receptor 1 (CD204)", "diseases": [ "lichen planopilaris / CCCA" ], "pathway": "M2 macrophage-mediated fibrosis / lipid scavenging", "twin_node": "APO", "effect": "+", "role": "driver", "drugs": [], "mechanism": "Upregulated in severe extensive CCCA and high-activity LPP; marks M2/scavenger macrophages that clear toxic lipids and drive perifollicular fibrogenesis, a macrophage-mediated scarring mechanism distinct from T-cell-only models.", "evidence_paper_ids": [], "n_evidence": 0, "mention_count": 0, "sources": [ "discover:recent2024_gwas_trials" ], "in_model": false, "uncertain": false, "structure": { "accession": "P21757", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/P21757", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-P21757-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-P21757-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/P21757", "mean_plddt": 67.4, "plddt_band": "Low (50–70)", "n_residues": 451, "local_pdb": "digital_twin\\data\\structures\\P21757_AF.pdb" }, "uniprot": "P21757", "uniprot_name": "Macrophage scavenger receptor types I and II", "length": 451, "function": "Membrane glycoproteins implicated in the pathologic deposition of cholesterol in arterial walls during atherogenesis. Two types of receptor subunits exist. These receptors mediate the endocytosis of a diverse group of macromolecules, including modified low density lipoproteins (LDL) (PubMed:2251254). Isoform III does not internalize acetylated LDL (PubMed:9548586)", "pdb_count": 1, "pdb_ids": [ "7DPX" ], "grounding": [], "grounded_in_corpus": false }, { "gene": "NFATC1", "name": "Nuclear factor of activated T-cells, cytoplasmic 1", "diseases": [ "AGA" ], "pathway": "BMP-NFATc1 quiescence control", "twin_node": "BMP", "effect": "?", "role": "modulator", "drugs": [ "Cyclosporine A", "Tacrolimus" ], "mechanism": "BMP-induced transcription factor that enforces hair-follicle stem-cell quiescence by repressing CDK4, and its decline with age permits aberrant activation and exhaustion.", "evidence_paper_ids": [], "n_evidence": 0, "mention_count": 0, "sources": [ "discover:HFSC" ], "in_model": false, "uncertain": false, "structure": { "accession": "O95644", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/O95644", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-O95644-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-O95644-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/O95644", "mean_plddt": 56.8, "plddt_band": "Low (50–70)", "n_residues": 943, "local_pdb": "digital_twin\\data\\structures\\O95644_AF.pdb" }, "uniprot": "O95644", "uniprot_name": "Nuclear factor of activated T-cells, cytoplasmic 1", "length": 943, "function": "Plays a role in the inducible expression of cytokine genes in T-cells, especially in the induction of the IL-2 or IL-4 gene transcription. Also controls gene expression in embryonic cardiac cells. Could regulate not only the activation and proliferation but also the differentiation and programmed death of T-lymphocytes as well as lymphoid and non-lymphoid cells (PubMed:10358178). Required for osteoclastogenesis and regulates many genes important for osteoclast differentiation and function (By similarity)", "pdb_count": 3, "pdb_ids": [ "1A66", "1NFA", "5SVE" ], "grounding": [ { "paper": "Retinoic acid drives hair follicle stem cell activation via Wnt β‐catenin signalling in androgenetic alopecia", "quote": "ssion of CD200 in HFSCs was inhib- ited with the addition of BMS493 (Figure 4d,e). Additionally, qPCR revealed that RA downregulated the mRNA expres- sion of the stemness markers NFATc1, NANOG and OCT4 and upregulated the expression of the differentiation mark- ers GATA3 and LEF-­1 (Figure 4f). Toge", "n_hits": 5 }, { "paper": "Overexpression of MYB in the skin induces alopecia and epidermal hyperplasia", "quote": "re in telogen, KTR15-positive cells were significantly reduced in K5-Myb hair follicles (Fig. 4b). Similarly, the hair follicle stem cell markers CD34 (Trempus et al., 2003) and NFATc1 (Horsley et al., 2008, Tumbar et al., 2004) were also found downregulated in hair follicles of K5-Myb mice (Fig. 4c", "n_hits": 3 }, { "paper": "Single‐Cell RNA Sequencing Highlights a Contribution of Human Amniotic Mesenchymal Stem Cells‐Derived Exosomes to Androgenetic Alopecia", "quote": "18+; migrating bulge cell, migraBulge, Bgn+; hair germ cell, HG, Icam1+; hair shaft cell, HS, Krt75+; inner root sheath cell, IRS, Krt35+). OuterBulge and innerBulge expressing Nfatc1 and Foxc1, HFSC markers (Figure 4C and Figure S1A), were found at the start of differentiation, while HG, IRS, and H", "n_hits": 3 }, { "paper": "The C3H HeJ mouse and DEBR rat models for alopecia areata review of preclinical drug screening approaches and results", "quote": "CsA may induce hair growth by inhibiting PPP3CA which is needed for nuclear localization of the protein nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 1 (NFATC1) in the bulge region. NFATC1 is activated by bone morphogenic protein (BMP) signaling which results in transcripti", "n_hits": 3 } ], "grounded_in_corpus": true }, { "gene": "OSM", "name": "Oncostatin M", "diseases": [ "AGA", "TelogenEffluvium" ], "pathway": "OSM/OSMR -> JAK2-STAT5 (HFSC quiescence)", "twin_node": "INF", "effect": "+", "role": "driver", "drugs": [ "OSM/OSMR-targeting antibodies (in development for other indications)" ], "mechanism": "IL-6-family cytokine released by TREM2+ trichophages that signals through OSMR/JAK-STAT5 to hold hair follicle stem cells in dormancy. Pharmacologic OSM/OSMR inhibition (or JAK-STAT5 blockade) de-represses HFSCs and triggers anagen, repositioning an inflammation-associated cytokine as a hair-cycle target.", "evidence_paper_ids": [], "n_evidence": 0, "mention_count": 0, "sources": [ "discover:recent" ], "in_model": false, "uncertain": false, "structure": { "accession": "P13725", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/P13725", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-P13725-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-P13725-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/P13725", "mean_plddt": 78.7, "plddt_band": "Confident (70–90)", "n_residues": 252, "local_pdb": "digital_twin\\data\\structures\\P13725_AF.pdb" }, "uniprot": "P13725", "uniprot_name": "Oncostatin-M", "length": 252, "function": "Growth regulator. Inhibits the proliferation of a number of tumor cell lines. Stimulates proliferation of AIDS-KS cells. It regulates cytokine production, including IL-6, G-CSF and GM-CSF from endothelial cells. Uses both type I OSM receptor (heterodimers composed of LIFR and IL6ST) and type II OSM receptor (heterodimers composed of OSMR and IL6ST). Involved in the maturation of fetal hepatocytes, thereby promoting liver development and regeneration (By similarity)", "pdb_count": 3, "pdb_ids": [ "1EVS", "8V29", "8V2A" ], "grounding": [ { "paper": "JAK-STAT1 as therapeutic target for EGFR deficiency-associated inflammation and scarring alopecia", "quote": "onment in EGFRΔEgr2 mice, with prominent Il17-producing γδT cells and ILC3s, Il4 and Il13 producing CD4 Th2 cells and ILC2s, Ifnγ producing CD8 T-cells and NK cells and IL1α/β and OSM expressing macrophages. Given the importance of the JAK-STAT cascade in the hair follicles of EGFRΔEgr2 mice, we nex", "n_hits": 6 } ], "grounded_in_corpus": true }, { "gene": "PADI3", "name": "Peptidyl arginine deiminase 3", "diseases": [ "CIA" ], "pathway": "hair-shaft protein citrullination / inner root sheath integrity", "twin_node": "—", "effect": "?", "role": "driver", "drugs": [], "mechanism": "Loss-of-function variants in ~24% of CCCA patients; PADI3 citrullinates trichohyalin and S100A3 to assemble the hair shaft and inner root sheath, and its deficiency produces fragile shafts and follicular scarring. Confirmed and extended in 2025.", "evidence_paper_ids": [], "n_evidence": 0, "mention_count": 0, "sources": [ "discover:recent2024_gwas_trials" ], "in_model": false, "uncertain": false, "structure": { "accession": "Q9ULW8", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/Q9ULW8", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-Q9ULW8-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-Q9ULW8-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/Q9ULW8", "mean_plddt": 93.7, "plddt_band": "Very high (≥90)", "n_residues": 664, "local_pdb": "digital_twin\\data\\structures\\Q9ULW8_AF.pdb" }, "uniprot": "Q9ULW8", "uniprot_name": "Protein-arginine deiminase type-3", "length": 664, "function": "Catalyzes the deimination of arginine residues of proteins", "pdb_count": 7, "pdb_ids": [ "6CE1", "7D4Y", "7D56", "7D5R", "7D5V", "7D8N", "7DAN" ], "grounding": [ { "paper": "Alopecia areata susceptibility variant in MHC region impacts expressions of genes contributing to hair keratinization and is involved in hair loss", "quote": "e manufacturer's protocol. The primer-probe sets were as follows: Mm00652053_g1 (Krt34), Mm02345064_m1 (Krt73), Mm04208593_s1 (Krtap3-3), Mm04336701_s1 (Krtap16-1), Mm00478075_m1 (Padi3), Mm01214103_g1 (S100a3), Mm00461542_m1 (Cchcr1), and Mm99999915_g1 (Gapdh) (Thermo Fisher Scientific). All PCR rea", "n_hits": 14 }, { "paper": "The Alopecia Areata Phenotype Is Induced by the Water Avoidance Stress Test In cchcr1-Deficient Mice", "quote": "ponents of the hair shaft and are specifically expressed in the medulla, cortex, and cuticle. Other upregulated genes included S100 calcium binding protein A3 (S100A3, substrate of PADI3), trichohyalin (Tchh, substrate of PADI3), peptidyl arginine deaminase type III (Padi 3, related to posttranslatio", "n_hits": 3 } ], "grounded_in_corpus": true }, { "gene": "PTH1R", "name": "Parathyroid hormone/parathyroid hormone-related peptide receptor (target of PTH-CBD)", "diseases": [ "CIA" ], "pathway": "GPCR (PTH/PTHrP)", "twin_node": "—", "effect": "?", "role": "protector", "drugs": [ "Abaloparatide / Teriparatide (PTH1R agonists)", "PTH-CBD (collagen-binding PTH agonist)" ], "mechanism": "Follicular PTH1R signaling promotes hair-cycle progression; a collagen-binding PTH agonist (PTH-CBD) accelerates anagen re-entry and reduces chemotherapy- and alopecia-areata-associated hair loss in models.", "evidence_paper_ids": [], "n_evidence": 0, "mention_count": 0, "sources": [ "discover:CIA" ], "in_model": false, "uncertain": false, "structure": { "accession": "Q03431", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/Q03431", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-Q03431-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-Q03431-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/Q03431", "mean_plddt": 71.0, "plddt_band": "Confident (70–90)", "n_residues": 593, "local_pdb": "digital_twin\\data\\structures\\Q03431_AF.pdb" }, "uniprot": "Q03431", "uniprot_name": "Parathyroid hormone/parathyroid hormone-related peptide receptor", "length": 593, "function": "G-protein-coupled receptor for parathyroid hormone (PTH) and for parathyroid hormone-related peptide (PTHLH) (PubMed:10913300, PubMed:18375760, PubMed:19674967, PubMed:27160269, PubMed:30975883, PubMed:35932760, PubMed:8397094). Ligand binding causes a conformation change that triggers signaling via guanine nucleotide-binding proteins (G proteins) and modulates the activity of downstream effectors, such as adenylate cyclase (cAMP) (PubMed:30975883, PubMed:35932760). PTH1R is coupled to G(s) G alpha proteins and mediates activation of adenylate cyclase activity (PubMed:20172855, PubMed:30975883", "pdb_count": 36, "pdb_ids": [ "1BL1", "3C4M", "3H3G", "3L2J", "4Z8J", "5EMB", "6NBF", "6NBH" ], "grounding": [], "grounded_in_corpus": false }, { "gene": "S100A3", "name": "S100 calcium binding protein A3", "diseases": [ "CIA" ], "pathway": "PADI3 substrate / cuticle calcium signaling", "twin_node": "—", "effect": "?", "role": "driver", "drugs": [], "mechanism": "Cuticle-specific PADI3 substrate; a CCCA variant reduces citrullination by PADI3, impairing hair-cuticle assembly and contributing to the fragile-shaft mechanism underlying central centrifugal scarring alopecia.", "evidence_paper_ids": [], "n_evidence": 0, "mention_count": 0, "sources": [ "discover:recent2024_gwas_trials" ], "in_model": false, "uncertain": false, "structure": { "accession": "P33764", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/P33764", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-P33764-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-P33764-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/P33764", "mean_plddt": 81.5, "plddt_band": "Confident (70–90)", "n_residues": 101, "local_pdb": "digital_twin\\data\\structures\\P33764_AF.pdb" }, "uniprot": "P33764", "uniprot_name": "Protein S100-A3", "length": 101, "function": "Binds both calcium and zinc. May be involved in calcium-dependent cuticle cell differentiation, hair shaft and hair cuticular barrier formation", "pdb_count": 5, "pdb_ids": [ "1KSO", "3NSI", "3NSK", "3NSL", "3NSO" ], "grounding": [ { "paper": "Alopecia areata susceptibility variant in MHC region impacts expressions of genes contributing to hair keratinization and is involved in hair loss", "quote": "ol. The primer-probe sets were as follows: Mm00652053_g1 (Krt34), Mm02345064_m1 (Krt73), Mm04208593_s1 (Krtap3-3), Mm04336701_s1 (Krtap16-1), Mm00478075_m1 (Padi3), Mm01214103_g1 (S100a3), Mm00461542_m1 (Cchcr1), and Mm99999915_g1 (Gapdh) (Thermo Fisher Scientific). All PCR reactions were performed i", "n_hits": 8 }, { "paper": "The Alopecia Areata Phenotype Is Induced by the Water Avoidance Stress Test In cchcr1-Deficient Mice", "quote": "major structural components of the hair shaft and are specifically expressed in the medulla, cortex, and cuticle. Other upregulated genes included S100 calcium binding protein A3 (S100A3, substrate of PADI3), trichohyalin (Tchh, substrate of PADI3), peptidyl arginine deaminase type III (Padi 3, relat", "n_hits": 2 } ], "grounded_in_corpus": true }, { "gene": "SCUBE3", "name": "Signal peptide, CUB and EGF-like domain-containing protein 3", "diseases": [ "AGA" ], "pathway": "TGF-beta/SHH activation (dermal papilla anagen signal)", "twin_node": "BMP", "effect": "-", "role": "protector", "drugs": [ "AMP-126", "AMP-303 (Amplifica, Phase 1/2)" ], "mechanism": "Dermal-papilla-secreted morphogen that activates TGF-beta/SMAD and Hedgehog signaling in epithelial progenitors to drive robust anagen entry. Identified in 2022 as a potent endogenous hair-growth activator; recombinant/peptide forms reactivate dormant follicles. Basis of Amplifica clinical candidates (AMP-303).", "evidence_paper_ids": [], "n_evidence": 0, "mention_count": 0, "sources": [ "discover:recent" ], "in_model": false, "uncertain": false, "structure": { "accession": "Q8IX30", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/Q8IX30", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-Q8IX30-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-Q8IX30-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/Q8IX30", "mean_plddt": 77.1, "plddt_band": "Confident (70–90)", "n_residues": 993, "local_pdb": "digital_twin\\data\\structures\\Q8IX30_AF.pdb" }, "uniprot": "Q8IX30", "uniprot_name": "Signal peptide, CUB and EGF-like domain-containing protein 3", "length": 993, "function": "Is a positive regulator of the BMP signaling pathway, required for proper chondrogenesis, osteogenesis and skeletal development. It acts as a coreceptor for BMP ligands, particularly BMP2 and BMP4, facilitating their interactions with BMP type I receptors (PubMed:33308444). It is required for ligand-induced recruitment of BMP receptors to lipid rafts (By similarity). Binds to TGFBR2 and activates TGFB signaling. In lung cancer cells, could serve as an endogenous autocrine and paracrine ligand of TGFBR2, which could regulate TGFBR2 signaling and hence modulate epithelial-mesenchymal transition ", "pdb_count": 0, "pdb_ids": [], "grounding": [], "grounded_in_corpus": false }, { "gene": "SFRP4", "name": "Secreted frizzled related protein 4", "diseases": [ "CIA" ], "pathway": "Wnt antagonism / fibrosis", "twin_node": "Wnt", "effect": "-", "role": "driver", "drugs": [], "mechanism": "Upregulated in severe extensive CCCA; as a secreted Wnt antagonist it suppresses the Wnt/beta-catenin signals required for follicle regeneration while promoting a profibrotic dermal program, biasing the follicle toward scarring.", "evidence_paper_ids": [], "n_evidence": 0, "mention_count": 0, "sources": [ "discover:recent2024_gwas_trials" ], "in_model": false, "uncertain": false, "structure": { "accession": "Q6FHJ7", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/Q6FHJ7", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-Q6FHJ7-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-Q6FHJ7-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/Q6FHJ7", "mean_plddt": 78.4, "plddt_band": "Confident (70–90)", "n_residues": 346, "local_pdb": "digital_twin\\data\\structures\\Q6FHJ7_AF.pdb" }, "uniprot": "Q6FHJ7", "uniprot_name": "Secreted frizzled-related protein 4", "length": 346, "function": "Soluble frizzled-related proteins (sFRPS) function as modulators of Wnt signaling through direct interaction with Wnts. They have a role in regulating cell growth and differentiation in specific cell types (By similarity). SFRP4 plays a role in bone morphogenesis. May also act as a regulator of adult uterine morphology and function. May also increase apoptosis during ovulation possibly through modulation of FZ1/FZ4/WNT4 signaling (By similarity). Has phosphaturic effects by specifically inhibiting sodium-dependent phosphate uptake (PubMed:12952927)", "pdb_count": 0, "pdb_ids": [], "grounding": [ { "paper": "Multi-layered environmental regulation on the homeostasis of stem cells The saga of hair growth and alopecia", "quote": "e stem cell activity [18]. We further developed this concept through different animal models and mathematical simulations [19]. We identified some Wnt inhibitors, such as Dkk1 and Sfrp4 located in the dermal region during refractory telogen and autonomous anagen phases, just like the expression patt", "n_hits": 2 } ], "grounded_in_corpus": true }, { "gene": "SH2B3", "name": "SH2B adaptor protein 3 (LNK)", "diseases": [ "AA" ], "pathway": "JAK-STAT negative regulation / cytokine signaling", "twin_node": "INF", "effect": "-", "role": "modulator", "drugs": [], "mechanism": "AA-associated locus at 12q24.12 (SH2B3/ATXN2); LNK is a negative regulator of JAK2 and cytokine receptor signaling, linking the genetic risk architecture to the JAK-STAT axis exploited by current AA therapeutics.", "evidence_paper_ids": [], "n_evidence": 0, "mention_count": 0, "sources": [ "discover:recent2024_gwas_trials" ], "in_model": false, "uncertain": false, "structure": { "accession": "Q9UQQ2", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/Q9UQQ2", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-Q9UQQ2-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-Q9UQQ2-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/Q9UQQ2", "mean_plddt": 62.1, "plddt_band": "Low (50–70)", "n_residues": 575, "local_pdb": "digital_twin\\data\\structures\\Q9UQQ2_AF.pdb" }, "uniprot": "Q9UQQ2", "uniprot_name": "SH2B adapter protein 3", "length": 575, "function": "Links T-cell receptor activation signal to phospholipase C-gamma-1, GRB2 and phosphatidylinositol 3-kinase", "pdb_count": 0, "pdb_ids": [], "grounding": [], "grounded_in_corpus": false }, { "gene": "SOCS1", "name": "Suppressor of cytokine signaling 1", "diseases": [ "AA" ], "pathway": "JAK-STAT negative feedback", "twin_node": "INF", "effect": "-", "role": "protector", "drugs": [], "mechanism": "Endogenous brake on JAK-STAT/IFN-gamma signaling; insufficient SOCS1 activity allows unchecked interferon signaling that sustains immune-privilege collapse in AA.", "evidence_paper_ids": [], "n_evidence": 0, "mention_count": 0, "sources": [ "discover:AA" ], "in_model": false, "uncertain": false, "structure": { "accession": "O15524", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/O15524", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-O15524-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-O15524-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/O15524", "mean_plddt": 83.1, "plddt_band": "Confident (70–90)", "n_residues": 211, "local_pdb": "digital_twin\\data\\structures\\O15524_AF.pdb" }, "uniprot": "O15524", "uniprot_name": "Suppressor of cytokine signaling 1", "length": 211, "function": "Essential negative regulator of type I and type II interferon (IFN) signaling, as well as that of other cytokines, including IL2, IL4, IL6 and leukemia inhibitory factor (LIF) (PubMed:32499645, PubMed:33087723). Downregulates cytokine signaling by inhibiting the JAK/STAT signaling pathway. Acts by binding to JAK proteins and to IFNGR1 and inhibiting their kinase activity. In vitro, suppresses Tec protein-tyrosine activity (PubMed:9341160). Regulates IFN-gamma (IFNG)-mediated sensory neuron survival (By similarity). Probable substrate recognition component of an ECS (Elongin BC-CUL2/5-SOCS-box ", "pdb_count": 0, "pdb_ids": [], "grounding": [], "grounded_in_corpus": false }, { "gene": "SPP1", "name": "Osteopontin", "diseases": [ "AGA", "TelogenEffluvium" ], "pathway": "Osteopontin (OPN)-CD44 (HFSC hyperactivation)", "twin_node": "HFSC", "effect": "+", "role": "protector", "drugs": [ "recombinant osteopontin / OPN peptides (preclinical)" ], "mechanism": "Secreted by senescent melanocytes in pigmented nevi; signals via CD44 on epithelial hair stem cells to potently hyperactivate HFSC proliferation and drive robust hair growth. Necessary and sufficient for nevus-associated hypertrichosis. Re-frames senescence as a pro-regenerative cue and nominates OPN as an anagen-inducing biologic.", "evidence_paper_ids": [], "n_evidence": 0, "mention_count": 0, "sources": [ "discover:recent" ], "in_model": false, "uncertain": false, "uniprot_override": "P10451", "structure": { "accession": "P10451", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/P10451", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-P10451-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-P10451-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/P10451", "mean_plddt": 53.4, "plddt_band": "Low (50–70)", "n_residues": 314, "local_pdb": "digital_twin\\data\\structures\\P10451_AF.pdb" }, "uniprot": "P10451", "uniprot_name": "Osteopontin", "length": 314, "function": "Major non-collagenous bone protein that binds tightly to hydroxyapatite. Appears to form an integral part of the mineralized matrix. Probably important to cell-matrix interaction", "pdb_count": 3, "pdb_ids": [ "3CXD", "3DSF", "9EOU" ], "grounding": [ { "paper": "Promotion of Hair Regrowth in Androgenetic Alopecia with Supplemented Erzhi Wan Exploring Its Mechanism Using Network Pharmacology and Molecular Docking", "quote": "PPARA Mohanlian MOL000098 Quercetin PPARD Mohanlian MOL000098 Quercetin HSF1 Mohanlian MOL000098 Quercetin CXCL10 Mohanlian MOL000098 Quercetin CHUK Mohanlian MOL000098 Quercetin SPP1 Mohanlian MOL000098 Quercetin RUNX2 Mohanlian MOL000098 Quercetin RASSF1 Mohanlian MOL000098 Quercetin E2F1 Mohanlia", "n_hits": 2 } ], "grounded_in_corpus": true }, { "gene": "SQSTM1", "name": "Sequestosome-1 (p62)", "diseases": [ "AGA" ], "pathway": "Selective autophagy / KEAP1-NRF2 stress", "twin_node": "APO", "effect": "?", "role": "modulator", "drugs": [], "mechanism": "Autophagy receptor that links cargo clearance to NRF2 antioxidant signaling, and its accumulation reports autophagic failure and oxidative stress in the aging niche.", "evidence_paper_ids": [], "n_evidence": 0, "mention_count": 0, "sources": [ "discover:HFSC" ], "in_model": false, "uncertain": false, "structure": { "accession": "Q13501", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/Q13501", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-Q13501-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-Q13501-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/Q13501", "mean_plddt": 67.2, "plddt_band": "Low (50–70)", "n_residues": 440, "local_pdb": "digital_twin\\data\\structures\\Q13501_AF.pdb" }, "uniprot": "Q13501", "uniprot_name": "Sequestosome-1", "length": 440, "function": "Molecular adapter required for selective macroautophagy (aggrephagy) by acting as a bridge between polyubiquitinated proteins and autophagosomes (PubMed:15340068, PubMed:15953362, PubMed:16286508, PubMed:17580304, PubMed:20168092, PubMed:22017874, PubMed:22622177, PubMed:24128730, PubMed:28404643, PubMed:29343546, PubMed:29507397, PubMed:31857589, PubMed:33509017, PubMed:34471133, PubMed:34893540, PubMed:35831301, PubMed:37306101, PubMed:37802024). Promotes the recruitment of ubiquitinated cargo proteins to autophagosomes via multiple domains that bridge proteins and organelles in different st", "pdb_count": 24, "pdb_ids": [ "1Q02", "2JY7", "2JY8", "2K0B", "2KNV", "4MJS", "4UF8", "4UF9" ], "grounding": [ { "paper": "Impaired autophagy promotes hair loss in the C3H HeJ mouse model of alopecia areata", "quote": "ATG4B gene. To test whether autophagy might contribute to disease pathogenesis in AA, we investigated autophagic activity in C3H/HeJ mouse model. We found that autophagy protein SQSTM1 accumulated in HF of AA mice, while in immune cells from AA skin-draining lymph nodes SQSTM1 was not altered, sugge", "n_hits": 24 }, { "paper": "ISEV2025 Abstract Book.", "quote": "was used as a positive control. Histological charac- teristics were evaluated using Fast Green/Safranin-O staining, whereas phosphorylated ribosomal protein S6 (phospho-RPS6), and SQSTM1 were studied by immunostaining. Results: Our findings reveal that dynasore regulates longitudinal bone growth in ", "n_hits": 3 } ], "grounded_in_corpus": true }, { "gene": "STAT5B", "name": "Signal transducer and activator of transcription 5B", "diseases": [ "AA" ], "pathway": "JAK-STAT", "twin_node": "INF", "effect": "+", "role": "driver", "drugs": [], "mechanism": "Acts redundantly with STAT5A downstream of IL-15/IL-2 to sustain autoreactive cytotoxic T-cell expansion and is a key effector blocked indirectly by JAK1/JAK3 inhibition in AA.", "evidence_paper_ids": [], "n_evidence": 0, "mention_count": 0, "sources": [ "discover:AA" ], "in_model": false, "uncertain": false, "structure": { "accession": "P51692", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/P51692", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-P51692-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-P51692-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/P51692", "mean_plddt": 85.2, "plddt_band": "Confident (70–90)", "n_residues": 787, "local_pdb": "digital_twin\\data\\structures\\P51692_AF.pdb" }, "uniprot": "P51692", "uniprot_name": "Signal transducer and activator of transcription 5B", "length": 787, "function": "Carries out a dual function: signal transduction and activation of transcription (PubMed:29844444). Mediates cellular responses to the cytokine KITLG/SCF and other growth factors. Binds to the GAS element and activates PRL-induced transcription. Positively regulates hematopoietic/erythroid differentiation", "pdb_count": 2, "pdb_ids": [ "6MBW", "6MBZ" ], "grounding": [ { "paper": "Selective Janus kinase 1 inhibition resolves inflammation and restores hair growth offering a viable treatment option for alopecia areata", "quote": "uded from further analysis, resulting in the following number of unique genes for each STAT pathway, STAT1: n = 235, STAT2: n = 38, STAT3: n = 582, STAT4: n = 221, STAT5A: n = 64, STAT5B: n = 187, STAT6: n = 164. 2.4.8 | RNAseq differential gene expression and enrichment analysis Differential gene e", "n_hits": 2 } ], "grounded_in_corpus": true }, { "gene": "TCF3", "name": "Transcription factor HES-1-like / TCF3 (E2A)", "diseases": [ "AGA" ], "pathway": "WNT/TCF stemness repression", "twin_node": "Wnt", "effect": "?", "role": "modulator", "drugs": [], "mechanism": "WNT-pathway transcription factor that, in the absence of beta-catenin, maintains the undifferentiated stem-cell state of the follicle niche.", "evidence_paper_ids": [], "n_evidence": 0, "mention_count": 0, "sources": [ "discover:HFSC" ], "in_model": false, "uncertain": false, "structure": { "accession": "Q9HCS4", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/Q9HCS4", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-Q9HCS4-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-Q9HCS4-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/Q9HCS4", "mean_plddt": 51.8, "plddt_band": "Low (50–70)", "n_residues": 588, "local_pdb": "digital_twin\\data\\structures\\Q9HCS4_AF.pdb" }, "uniprot": "Q9HCS4", "uniprot_name": "Transcription factor 7-like 1", "length": 588, "function": "Participates in the Wnt signaling pathway. Binds to DNA and acts as a repressor in the absence of CTNNB1, and as an activator in its presence. Necessary for the terminal differentiation of epidermal cells, the formation of keratohyalin granules and the development of the barrier function of the epidermis (By similarity). Down-regulates NQO1, leading to increased mitomycin c resistance", "pdb_count": 0, "pdb_ids": [], "grounding": [], "grounded_in_corpus": false }, { "gene": "TCF7", "name": "Transcription factor 7 (TCF-1)", "diseases": [ "AGA" ], "pathway": "WNT/beta-catenin effector", "twin_node": "Wnt", "effect": "+", "role": "protector", "drugs": [], "mechanism": "Beta-catenin-dependent WNT effector transcription factor that activates hair-follicle stem-cell proliferation and lineage commitment during anagen onset.", "evidence_paper_ids": [], "n_evidence": 0, "mention_count": 0, "sources": [ "discover:HFSC" ], "in_model": false, "uncertain": false, "structure": { "accession": "P36402", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/P36402", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-P36402-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-P36402-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/P36402", "mean_plddt": 57.1, "plddt_band": "Low (50–70)", "n_residues": 384, "local_pdb": "digital_twin\\data\\structures\\P36402_AF.pdb" }, "uniprot": "P36402", "uniprot_name": "Transcription factor 7", "length": 384, "function": "Transcriptional activator involved in T-cell lymphocyte differentiation. Necessary for the survival of CD4(+) CD8(+) immature thymocytes. Isoforms lacking the N-terminal CTNNB1 binding domain cannot fulfill this role. Binds to the T-lymphocyte-specific enhancer element (5'-WWCAAAG-3') found in the promoter of the CD3E gene. Represses expression of the T-cell receptor gamma gene in alpha-beta T-cell lineages (By similarity). Required for the development of natural killer receptor-positive lymphoid tissue inducer T-cells (By similarity). TLE1, TLE2, TLE3 and TLE4 repress transactivation mediated", "pdb_count": 0, "pdb_ids": [], "grounding": [ { "paper": "Pilose antler extracts promotes hair growth in androgenetic alopecia mice by activating hair follicle stem cells via the AKT and Wnt pathways", "quote": "ntiersin.org 10 Wang et al. 10.3389/fphar.2024.1410810 affect this pathway, the mRNA level of up-and downstream genes of Wnt/β-catenin was examined, including Axin1, Axin2, Lef1, Tcf7, c-Jun, Lgr6, and Survivin (Figures 6A–G), and protein level of β-catenin (Figures 6H–J, M) and its two ligands (WNT", "n_hits": 4 } ], "grounded_in_corpus": true }, { "gene": "TCHH", "name": "Trichohyalin", "diseases": [ "CIA" ], "pathway": "PADI3 substrate / inner root sheath cornification", "twin_node": "—", "effect": "?", "role": "driver", "drugs": [], "mechanism": "Pathogenic TCHH variants alter intracellular localization and reduce protein levels; as a major PADI3 substrate in the inner root sheath and medulla, defective trichohyalin compromises hair-shaft anchoring and predisposes to scarring alopecia.", "evidence_paper_ids": [], "n_evidence": 0, "mention_count": 0, "sources": [ "discover:recent2024_gwas_trials" ], "in_model": false, "uncertain": false, "structure": { "accession": "Q07283", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/Q07283", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-Q07283-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-Q07283-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/Q07283", "mean_plddt": 67.6, "plddt_band": "Low (50–70)", "n_residues": 1943, "local_pdb": "digital_twin\\data\\structures\\Q07283_AF.pdb" }, "uniprot": "Q07283", "uniprot_name": "Trichohyalin", "length": 1943, "function": "Intermediate filament-associated protein that associates in regular arrays with keratin intermediate filaments (KIF) of the inner root sheath cells of the hair follicle and the granular layer of the epidermis. It later becomes cross-linked to KIF by isodipeptide bonds. It may serve as scaffold protein, together with involucrin, in the organization of the cell envelope or even anchor the cell envelope to the KIF network. It may be involved in its own calcium-dependent postsynthetic processing during terminal differentiation", "pdb_count": 0, "pdb_ids": [], "grounding": [ { "paper": "Alopecia areata susceptibility variant in MHC region impacts expressions of genes contributing to hair keratinization and is involved in hair loss", "quote": "ontrib- utes to hair shaft rigidity [48]. Other up-regulated genes included peptidyl arginine deaminase type III (Padi3), S100 calcium binding protein A3 (S100A3), trichohya- lin (Tchh), and homeobox C13 (Hoxc13) (Supplementary Table 12) [49,50]. In cuticular cells, S100A3 is a substrate of PADI3, w", "n_hits": 7 } ], "grounded_in_corpus": true }, { "gene": "TLR2", "name": "Toll like receptor 2", "diseases": [ "AGA" ], "pathway": "innate immune sensing of microbiome lipids / NLRP3 priming", "twin_node": "INF", "effect": "+", "role": "driver", "drugs": [], "mechanism": "Free fatty acids generated by Cutibacterium acnes and Malassezia from scalp sebum activate TLR2- and NLRP3-linked innate signaling, driving perifollicular inflammation and stem-cell apoptosis in a microbiome-lipid-immune axis of AGA.", "evidence_paper_ids": [], "n_evidence": 0, "mention_count": 0, "sources": [ "discover:recent2024_gwas_trials" ], "in_model": false, "uncertain": false, "structure": { "accession": "O60603", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/O60603", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-O60603-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-O60603-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/O60603", "mean_plddt": 87.9, "plddt_band": "Confident (70–90)", "n_residues": 784, "local_pdb": "digital_twin\\data\\structures\\O60603_AF.pdb" }, "uniprot": "O60603", "uniprot_name": "Toll-like receptor 2", "length": 784, "function": "Cooperates with LY96 to mediate the innate immune response to bacterial lipoproteins and other microbial cell wall components. Cooperates with TLR1 or TLR6 to mediate the innate immune response to bacterial lipoproteins or lipopeptides (PubMed:17889651, PubMed:21078852). Acts via MYD88 and TRAF6, leading to NF-kappa-B activation, cytokine secretion and the inflammatory response. May also activate immune cells and promote apoptosis in response to the lipid moiety of lipoproteins (PubMed:10426995, PubMed:10426996). Recognizes mycoplasmal macrophage-activating lipopeptide-2kD (MALP-2), soluble tu", "pdb_count": 7, "pdb_ids": [ "1FYW", "1FYX", "1O77", "2Z7X", "2Z80", "6NIG", "8AR0" ], "grounding": [ { "paper": "ISEV2025 Abstract Book.", "quote": "mpared to the parent bacteria. These vesicles increased the expression of proteins related to oxidative stress and inflamma- tion in human nasal epithelial cells and activated the TLR2/4/5 and NOD1/2 receptors. In vivo, EcO83-EVs interacted with nasal-associated lymphoid tissue, were internalised by", "n_hits": 10 }, { "paper": "Immunoregulatory Effects of Myeloid-Derived Suppressor Cell Exosomes in Mouse Model of Autoimmune Alopecia Areata", "quote": "xpression of several T cell signaling molecules, MDSC-Exo exerted a minor impact on ζ-chain expression, ERK1/2 and JNK phosphorylation in AA LNC and SkIL. Except for upregulated TLR2 expression, AA LNC and SkIL did not strongly differ from that of naive mice. MDSC-Exo affected TLR6, Stat3, Stat4, an", "n_hits": 2 } ], "grounded_in_corpus": true }, { "gene": "TREM2", "name": "Triggering receptor expressed on myeloid cells 2", "diseases": [ "AGA", "TelogenEffluvium" ], "pathway": "TREM2+ macrophage / Oncostatin M -> JAK-STAT5 (HFSC quiescence)", "twin_node": "INF", "effect": "+", "role": "driver", "drugs": [ "anti-OSM / OSMR blockade (conceptual)" ], "mechanism": "Marks a dermal trichophage macrophage subset that secretes Oncostatin M to activate JAK-STAT5 in bulge HFSCs, enforcing quiescence and inhibiting hair growth; TREM2+ macrophages decrease just before anagen. Depleting TREM2 macrophages or blocking OSM induces premature anagen. A novel immune-niche brake on the hair cycle.", "evidence_paper_ids": [], "n_evidence": 0, "mention_count": 0, "sources": [ "discover:recent" ], "in_model": false, "uncertain": false, "structure": { "accession": "Q9NZC2", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/Q9NZC2", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-Q9NZC2-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-Q9NZC2-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/Q9NZC2", "mean_plddt": 76.8, "plddt_band": "Confident (70–90)", "n_residues": 230, "local_pdb": "digital_twin\\data\\structures\\Q9NZC2_AF.pdb" }, "uniprot": "Q9NZC2", "uniprot_name": "Triggering receptor expressed on myeloid cells 2", "length": 230, "function": "Forms a receptor signaling complex with TYROBP which mediates signaling and cell activation following ligand binding (PubMed:10799849). Acts as a receptor for amyloid-beta protein 42, a cleavage product of the amyloid-beta precursor protein APP, and mediates its uptake and degradation by microglia (PubMed:27477018, PubMed:29518356). Binding to amyloid-beta 42 mediates microglial activation, proliferation, migration, apoptosis and expression of pro-inflammatory cytokines, such as IL6R and CCL3, and the anti-inflammatory cytokine ARG1 (By similarity). Acts as a receptor for lipoprotein particles", "pdb_count": 15, "pdb_ids": [ "5ELI", "5UD7", "5UD8", "6B8O", "6XDS", "6Y6C", "6YMQ", "6YYE" ], "grounding": [ { "paper": "CXCL12 Drives Reversible Fibroimmune Remodeling in Androgenetic Alopecia Revealed by Single-Cell RNA Sequencing", "quote": "extracellular matrix deposition. In parallel, paracrine CXCL12-CXCR4 signaling reprogrammed Sox2+Twist1+ dermal papilla cells (DPCs) and promoted the accumulation of pro-fibrotic Trem2+ macrophages, con- tributing to impaired hair follicle regeneration. Notably, CXCL12 blockade attenuated these stro", "n_hits": 21 }, { "paper": "ISEV2025 Abstract Book.", "quote": "tumour tropism and precise cargo delivery. While PD-L1 blockade has reshaped immunotherapy, its efficacy remains limited by immunosuppressive tumour-associated macrophages (TAMs). TREM2, a key regulator of TAM-mediated immunosuppression and a myeloid checkpoint receptor, sustains an immunosuppressiv", "n_hits": 5 }, { "paper": "JAK-STAT1 as therapeutic target for EGFR deficiency-associated inflammation and scarring alopecia", "quote": "self-tolerance, upregulation of “no danger” signals such as CD200, generation of an immunosuppressive microenvironment via TGF-β secretion, and recruitment of regulatory T cells, Trem2+ macro- phages, and invariant natural killer (NK) T cells (Agudo et al, 2018; Ali et al, 2017; Cohen et al, 2024; L", "n_hits": 2 } ], "grounded_in_corpus": true }, { "gene": "TRPS1", "name": "Transcriptional repressor GATA binding 1", "diseases": [ "AGA" ], "pathway": "Wnt regulation downstream of YAP inhibition", "twin_node": "Wnt", "effect": "+", "role": "protector", "drugs": [], "mechanism": "YAP inhibition regenerates new hair follicles by activating Trps1, a GATA-type Wnt-pathway regulator controlling dermal-papilla inductivity; identifies TRPS1 as a downstream effector node for mechano-activated follicle neogenesis.", "evidence_paper_ids": [], "n_evidence": 0, "mention_count": 0, "sources": [ "discover:recent2024_gwas_trials" ], "in_model": false, "uncertain": false, "structure": { "accession": "Q9UHF7", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/Q9UHF7", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-Q9UHF7-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-Q9UHF7-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/Q9UHF7", "mean_plddt": 48.5, "plddt_band": "Very low (<50)", "n_residues": 1281, "local_pdb": "digital_twin\\data\\structures\\Q9UHF7_AF.pdb" }, "uniprot": "Q9UHF7", "uniprot_name": "Zinc finger transcription factor Trps1", "length": 1281, "function": "Transcriptional repressor. Binds specifically to GATA sequences and represses expression of GATA-regulated genes at selected sites and stages in vertebrate development. Regulates chondrocyte proliferation and differentiation. Executes multiple functions in proliferating chondrocytes, expanding the region of distal chondrocytes, activating proliferation in columnar cells and supporting the differentiation of columnar into hypertrophic chondrocytes", "pdb_count": 0, "pdb_ids": [], "grounding": [], "grounded_in_corpus": false }, { "gene": "TSLP", "name": "Thymic stromal lymphopoietin", "diseases": [ "AA" ], "pathway": "epithelial alarmin / IL-7R-TSLPR signaling", "twin_node": "INF", "effect": "+", "role": "driver", "drugs": [], "mechanism": "Drug target of bempikibart (anti-IL-7Ralpha) which blocks both IL-7 and TSLP signaling; TSLP is an epithelial alarmin that primes T-cell and dendritic-cell activation upstream of follicular autoimmunity, evaluated in Phase 2 AA.", "evidence_paper_ids": [], "n_evidence": 0, "mention_count": 0, "sources": [ "discover:recent2024_gwas_trials" ], "in_model": false, "uncertain": false, "structure": { "accession": "Q969D9", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/Q969D9", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-Q969D9-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-Q969D9-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/Q969D9", "mean_plddt": 79.1, "plddt_band": "Confident (70–90)", "n_residues": 159, "local_pdb": "digital_twin\\data\\structures\\Q969D9_AF.pdb" }, "uniprot": "Q969D9", "uniprot_name": "Thymic stromal lymphopoietin", "length": 159, "function": "Cytokine that induces the release of T-cell-attracting chemokines from monocytes and, in particular, enhances the maturation of CD11c(+) dendritic cells. Can induce allergic inflammation by directly activating mast cells", "pdb_count": 5, "pdb_ids": [ "5J11", "5J12", "5J13", "8QFZ", "8ZEU" ], "grounding": [ { "paper": "Blockade of IL-7 signaling suppresses inflammatory responses and reverses alopecia areata in C3H HeJ mice", "quote": "ed hair loss by 7 weeks after skin grafting. In contrast, none of anti–IL-7R-treated mice displayed any signs of hair loss (Fig. 3, A and B). The thymic stromal lymphopoietin (TSLP) receptor shares the IL-7R chain but pairs with the cytokine receptor like factor 2, rather than c, as the second ch", "n_hits": 11 } ], "grounded_in_corpus": true }, { "gene": "ULBP3", "name": "UL16 binding protein 3 (NKG2D ligand)", "diseases": [ "AA" ], "pathway": "NKG2D innate cytotoxicity / immune-privilege collapse", "twin_node": "INF", "effect": "+", "role": "driver", "drugs": [], "mechanism": "Stress-induced NKG2D ligand markedly upregulated in dermal sheath and dermal papilla of early active AA lesions; recruits NKG2D+ CD8+ T cells, NK cells and ILC1 to drive follicular cytotoxicity. 6q25 ULBP cluster is a GWAS hit and ULBP3 marks alopecia areata incognita.", "evidence_paper_ids": [], "n_evidence": 0, "mention_count": 0, "sources": [ "discover:recent2024_gwas_trials" ], "in_model": false, "uncertain": false, "structure": { "accession": "Q9BZM4", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/Q9BZM4", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-Q9BZM4-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-Q9BZM4-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/Q9BZM4", "mean_plddt": 81.6, "plddt_band": "Confident (70–90)", "n_residues": 244, "local_pdb": "digital_twin\\data\\structures\\Q9BZM4_AF.pdb" }, "uniprot": "Q9BZM4", "uniprot_name": "UL16-binding protein 3", "length": 244, "function": "Binds and activates the KLRK1/NKG2D receptor, mediating natural killer cell cytotoxicity", "pdb_count": 1, "pdb_ids": [ "1KCG" ], "grounding": [ { "paper": "Maternal IL-6 can cause T-cell-mediated juvenile alopecia by non-scarring follicular dystrophy in mice", "quote": "tnatal day 18. This alopecia was patchy and reversible (non-scarring) and was associated with upregulation of Ulbp1 expression, the only mouse homolog of the human AA-associated ULBP3 gene. Alopecia was also associated with inflammatory infiltration of hair follicles by lymphocytes, including alpha-", "n_hits": 2 }, { "paper": "Mechanism of PPARα agonist in alopecia areata", "quote": "cells, and macrophages, around affected hair folli­ cles. Genome-wide association studies (GWAS) have identified loci linked to innate and adap­ tive immune responses, including ULBP3 and ULBP6, which encode ligands for NKG2D [2]. These ligands target CD8+NKG2D+ T cells, contributing to AA progressi", "n_hits": 2 } ], "grounded_in_corpus": true }, { "gene": "VCAN", "name": "Versican core protein", "diseases": [ "AGA" ], "pathway": "Dermal-papilla ECM / inductivity", "twin_node": "DP", "effect": "+", "role": "protector", "drugs": [], "mechanism": "Proteoglycan that is a hallmark of inductive dermal-papilla extracellular matrix and its expression correlates with hair-inductive capacity and anagen maintenance.", "evidence_paper_ids": [], "n_evidence": 0, "mention_count": 0, "sources": [ "discover:HFSC" ], "in_model": false, "uncertain": false, "structure": { "accession": "P13611", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/P13611", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-P13611-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-P13611-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/P13611", "mean_plddt": 85.1, "plddt_band": "Confident (70–90)", "n_residues": 655, "local_pdb": "digital_twin\\data\\structures\\P13611_AF.pdb" }, "uniprot": "P13611", "uniprot_name": "Versican core protein", "length": 3396, "function": "May play a role in intercellular signaling and in connecting cells with the extracellular matrix. May take part in the regulation of cell motility, growth and differentiation. Binds hyaluronic acid", "pdb_count": 0, "pdb_ids": [], "grounding": [ { "paper": "JAM-A facilitates hair follicle regeneration in alopecia areata through functioning as ceRNA to protect VCAN expression in dermal papilla cells", "quote": "inical Medicine, 2022, 5: 1–13 DOI: 10.1093/pcmedi/pbac020 Research Article JAM-A facilitates hair follicle regeneration in alopecia areata through functioning as ceRNA to protect VCAN expression in dermal papilla cells Minjuan Wu 1,2,§, Chen Xu1,3,§, Junfeng Jiang1,§, Sha Xu1, Jun Xiong1, Xiaoming ", "n_hits": 101 } ], "grounded_in_corpus": true }, { "gene": "YAP1", "name": "Yes1 associated transcriptional regulator", "diseases": [ "AGA" ], "pathway": "Hippo / mechanotransduction in connective tissue sheath", "twin_node": "—", "effect": "?", "role": "driver", "drugs": [], "mechanism": "In an AGA model, cyclic mechanical strain on the connective-tissue sheath drives YAP/TAZ overactivation and progenitor apoptosis; conversely YAP inhibition regenerates follicles via Trps1, defining a mechanobiological axis in pattern hair loss.", "evidence_paper_ids": [], "n_evidence": 0, "mention_count": 0, "sources": [ "discover:recent2024_gwas_trials" ], "in_model": false, "uncertain": false, "structure": { "accession": "P46937", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/P46937", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-P46937-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-P46937-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/P46937", "mean_plddt": 57.4, "plddt_band": "Low (50–70)", "n_residues": 504, "local_pdb": "digital_twin\\data\\structures\\P46937_AF.pdb" }, "uniprot": "P46937", "uniprot_name": "Transcriptional coactivator YAP1", "length": 504, "function": "Transcriptional regulator with dual roles as a coactivator and corepressor. Critical downstream regulatory target in the Hippo signaling pathway, crucial for organ size control and tumor suppression by restricting proliferation and promoting apoptosis (PubMed:17974916, PubMed:18280240, PubMed:18579750, PubMed:21364637, PubMed:30447097). The Hippo signaling pathway core involves a kinase cascade featuring STK3/MST2 and STK4/MST1, along with its regulatory partner SAV1, which phosphorylates and activates LATS1/2 in complex with their regulatory protein, MOB1. This activation leads to the phospho", "pdb_count": 41, "pdb_ids": [ "1JMQ", "1K5R", "1K9Q", "1K9R", "2LAW", "2LAX", "2LAY", "2LTV" ], "grounding": [], "grounded_in_corpus": false }, { "gene": "ZEB1", "name": "Zinc finger E-box-binding homeobox 1", "diseases": [ "AGA" ], "pathway": "EMT / fibrotic remodeling", "twin_node": "—", "effect": "?", "role": "driver", "drugs": [], "mechanism": "EMT-driving transcription factor that promotes mesenchymal, fibrotic remodeling of the dermal niche implicated in scarring alopecia and follicle destruction.", "evidence_paper_ids": [], "n_evidence": 0, "mention_count": 0, "sources": [ "discover:HFSC" ], "in_model": false, "uncertain": false, "structure": { "accession": "P37275", "af_entry_url": "https://alphafold.ebi.ac.uk/entry/P37275", "af_cif_url": "https://alphafold.ebi.ac.uk/files/AF-P37275-F1-model_v4.cif", "af_pdb_url": "https://alphafold.ebi.ac.uk/files/AF-P37275-F1-model_v4.pdb", "uniprot_url": "https://www.uniprot.org/uniprotkb/P37275", "mean_plddt": 47.9, "plddt_band": "Very low (<50)", "n_residues": 1124, "local_pdb": "digital_twin\\data\\structures\\P37275_AF.pdb" }, "uniprot": "P37275", "uniprot_name": "Zinc finger E-box-binding homeobox 1", "length": 1124, "function": "Acts as a transcriptional repressor. Inhibits interleukin-2 (IL-2) gene expression. Enhances or represses the promoter activity of the ATP1A1 gene depending on the quantity of cDNA and on the cell type. Represses E-cadherin promoter and induces an epithelial-mesenchymal transition (EMT) by recruiting SMARCA4/BRG1. Represses BCL6 transcription in the presence of the corepressor CTBP1. Positively regulates neuronal differentiation. Represses RCOR1 transcription activation during neurogenesis. Represses transcription by binding to the E box (5'-CANNTG-3'). In the absence of TGFB1, acts as a repre", "pdb_count": 1, "pdb_ids": [ "2E19" ], "grounding": [ { "paper": "ISEV2025 Abstract Book.", "quote": "and 12,000 EVs per cell. After 24 h, apoptosis and cell cycle analy- ses were performed. The expression of epithelial-mesenchymal transition (EMT)-related genes (CD44, CDH1, VIM, ZEB1, and CLDN1) was assessed by quantitative real-time PCR (qRT-PCR). Additionally, the expression of immune-related gen", "n_hits": 10 }, { "paper": "A combination therapy for androgenic alopecia based on quercetin and zinc copper dual-doped mesoporous silica nanocomposite microneedle patch", "quote": "e enhancers of Zn2+ ions. The DHT inhibition effect of Zn2+ might be ascribed to its regulating action on zinc-containing proteins such as zinc finger E-box binding homeobox 1 (ZEB1), which is directly related to DHT inhibitors and affects the content of DHT [64,65]. Apart from DHT attacking, persis", "n_hits": 2 } ], "grounded_in_corpus": true } ], "grounding_stats": { "fulltext_pdfs": 201, "in_model_grounded": 73, "in_model_total": 74, "catalog_grounded": 151, "catalog_total": 210 } }