alopecia/data/grounding_evidence.json

1468 lines
121 KiB
JSON
Raw Permalink Blame History

This file contains invisible Unicode characters

This file contains invisible Unicode characters that are indistinguishable to humans but may be processed differently by a computer. If you think that this is intentional, you can safely ignore this warning. Use the Escape button to reveal them.

This file contains Unicode characters that might be confused with other characters. If you think that this is intentional, you can safely ignore this warning. Use the Escape button to reveal them.

{
"AR": [
{
"paper": "The AR miR-221 IGF-1 pathway mediates the pathogenesis of androgenetic alopecia",
"n_hits": 10,
"quote": "of AR, plays a crucial role in the pathogenesis of AGA, making it a novel biomarker and potential therapeutic target for treating AGA. Keywords: androgenetic alopecia; miR-221; androgen receptor; IGF-1; dihydrotestosterone Introduction Androgenetic alopecia (AGA), also known as male pattern baldness"
},
{
"paper": "The Genetic Landscape of Androgenetic Alopecia Current Knowledge and Future Perspectives.",
"n_hits": 8,
"quote": "ide association studies have defined AGA as a highly polygenic trait with dozens of loci of small to moderate effect. Early studies built on classic candidate gene findings at the androgen receptor (AR) locus and the 20p11 region, but expanded the architecture substantially [16,17]. A landmark GWAS "
},
{
"paper": "2,5-Diazabicyclo[2.2.1]heptane in medicinal chemistry a treasure trove of therapeutic opportunities.",
"n_hits": 7,
"quote": "by modifying the ketone ring structure based on alectinib. The key compound (293) was obtained in a 54% yield and demonstrated potent ALK inhibition with an IC50 of 6.6 nM.225 The androgen receptor (AR), part of the nuclear hormone receptor superfamily, plays a vital role in both the development of "
},
{
"paper": "Dihydrotestosterone-induced hair regrowth inhibition by activating androgen receptor in C57BL6 mice simulates androgenetic alopecia",
"n_hits": 7,
"quote": "ss article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/). Original article Dihydrotestosterone-induced hair regrowth inhibition by activating androgen receptor in C57BL6 mice simulates androgenetic alopecia Danlan Fu 1, Junfei Huang 1, Kaitao Li 1, Yuxin Chen, Ye "
}
],
"SRD5A1": [
{
"paper": "Use of genetics in the prediction of success in male pattern hair loss therapy and mechanistic studies.",
"n_hits": 20,
"quote": "Chen et al., 2025; Liu et al., 2025b). Our recent work using pharmacogenetic panels has started to link specific single-nucleotide polymorphisms (SNPs) in genes such as SULT1A1, SRD5A1, SRD5A2, PTGES2, and PTGFR to differential responses to minoxidil and 5α-reductase inhibitors, and to patterns of n"
}
],
"SRD5A2": [
{
"paper": "Use of genetics in the prediction of success in male pattern hair loss therapy and mechanistic studies.",
"n_hits": 41,
"quote": "observations on LDOM dose response and concentration remain exploratory and should not yet inform clinical dose adjustment (Goren et al., 2014; Jimenez-Cauhe et al., 2025). 4.2 5-Alpha-Reductase inhibitors Type 1 and type 2 5α-reductase, encoded by SRD5A1 and SRD5A2, catalyse the conversion of testo"
},
{
"paper": "Xiaozhi Yufa decoction ameliorates androgenetic alopecia through inhibition of MAPK signaling and regulation of lipid metabolism",
"n_hits": 37,
"quote": "age-related changes (Xiao et al., 2025). Dihydrotestosterone (DHT) serves as the primary mediator of follicular miniaturization in genetically susceptible individuals. The enzyme 5α-reductase type 2 catalyzes the conversion of testosterone to DHT in hair follicles and sebaceous glands. DHT subsequen"
},
{
"paper": "Black phosphorus nanosheets encapsulated microneedle for multifunctional therapy for androgenic alopecia",
"n_hits": 25,
"quote": "ge 2 of 20 Xiong et al. Journal of Nanobiotechnology (2025) 23:147 heightened androgenic milieu and vascular insufficiency in the scalp. Specifically, the overexpressed 5α-reductase, increased androgen receptors (ARs), and elevated dihy- drotestosterone (DHT) production lead to the progres- sive min"
},
{
"paper": "Stauntonia hexaphylla Extract Ameliorates Androgenic Alopecia by Inhibiting Androgen Signaling in Testosterone-induced Alopecia Mice",
"n_hits": 20,
"quote": "Objectives: In this study, we evaluated the effects of an extract of S. hexaphylla on AGA models and its mechanisms of action. Methods: We studied S. hexaphylla extract to evaluate 5α-reductase and androgen receptor (AR) levels, apoptosis, and cell prolifer- ation in vitro and in vivo. In addition, p"
}
],
"CYP19A1": [
{
"paper": "Alleviation of Androgenetic Alopecia with Aqueous Paeonia lactiflora and Poria cocos Extract Intake through Suppressing the Steroid Hormone and Inflammatory Pathway",
"n_hits": 9,
"quote": "GA-PL group than in the AGA-Con group and similar to concentrations in the Normal-Con group, whereas serum 17β-estradiol concentrations showed the opposite pattern with increasing aromatase mRNA expression (p < 0.05). In the dorsal skin, DKK1 and NR3C2 mRNA expressions were significantly lower, but T"
},
{
"paper": "Clinical Practice Guidelines for Menopause An Executive Summary and Recommendations Indian Menopause Society 2026.",
"n_hits": 8,
"quote": "icacy and safety of ultra-low dose 0.005% estriol vaginal gel for the treatment of vulvovaginal atrophy in postmenopausal women with early breast cancer treated with nonsteroidal aromatase inhibitors: A phase II, randomized, double-blind, placebo-controlled trial. Menopause 2020;27:526-34. 154. Simo"
}
],
"CTNNB1": [
{
"paper": "Improvement of androgenic alopecia by extracellular vesicles secreted from hyaluronic acid-stimulated induced mesenchymal stem cells",
"n_hits": 129,
"quote": "licle dermal papilla cells undergoing testosterone-mediated AGA. Additionally, the expression of androgen receptor (AR) and relevant growth factors as well as key proteins of Wnt/β-catenin signaling pathway (β-catenin and phospho rylated GSK3β) was analyzed. Subsequently, AGA was induced in male C5"
},
{
"paper": "Restoration of follicular β-catenin signaling by mesenchymal stem cells promotes hair growth in mice with androgenetic alopecia",
"n_hits": 126,
"quote": "omoted hair growth, HFs density, skin thickness, and anagen phase activation, while inhibiting DPCs apoptosis, and promoting HFSCs proliferation. In vitro, hUCMSCs activated Wnt/β-catenin signaling in DPCs via Wntless (Wls), while stimulating growth factor secretion and HFSCs proliferation. Blocking"
},
{
"paper": "Low-frequency electromagnetic fields ameliorate testosterone-induced androgenetic alopecia in mice through LncRNA H19 miR-214-5p β-catenin signal pathway",
"n_hits": 114,
"quote": "Low-frequency electromagnetic fields ameliorate testosterone-induced androgenetic alopecia in mice through LncRNA H19/miR-214-5p/β-catenin signal pathway Jiang-Hua Cheng a,1, Chong-You a,1, Ting Hu b,1, Wei-Jun Fang a, Xiao-Min Niu a, Ke-Tao Du a,* a Department of Rehabilitation Medicine, South Chin"
},
{
"paper": "BFNB Enhances Hair Growth in C57BL 6 Mice through the",
"n_hits": 77,
"quote": "rez-Mora, S.; Ocampo-López, J.; Gómez-García, M.d.C.; Pérez-Ishiwara, D.G. BFNB Enhances Hair Growth in C57BL/6 Mice through the Induction of EGF and FGF7 Factors and the PI3K-AKT-β-Catenin Pathway. Int. J. Mol. Sci. 2023, 24, 12110. https:// doi.org/10.3390/ijms241512110 Academic Editor: Izabela Gr"
}
],
"WNT10B": [
{
"paper": "Subcutaneous injection of genetically engineered exosomes for androgenic alopecia treatment",
"n_hits": 16,
"quote": "tifunctional exosome-based targeted delivery platform, designated as EX104, through the engineering of HEK-293 cells to express a combination of therapeutical molecules, including WNT10B, VEGFA, and FGF7. EX104 reversed the hair follicle miniaturization phenotype in DHT-induced DPCs. Furthermore, it"
},
{
"paper": "VinegarProcessed Black Soybean Promotes Hair Growth and Prevents Alopecia via Wnt βCatenin Pathway",
"n_hits": 11,
"quote": "18 days. Outcomes were evaluated via trichogram scoring, hair length and weight analysis, histomorphometric evaluation, and Western blot quantification of β-­ catenin, GSK3β, and Wnt10b expression. To assess antialopecia effects, cyclophosphamide (100 mg·kg1) was intraperito- neally administered on"
},
{
"paper": "Pilose antler extracts promotes hair growth in androgenetic alopecia mice by activating hair follicle stem cells via the AKT and Wnt pathways",
"n_hits": 8,
"quote": "p-GSK3β-Ser9 (rabbit, Abclonal, AP1088, 1: 2000), GSK3β (rabbit, Abclonal, A11731, 1:2000), β-catenin (rabbit, Abclonal, A19657, 1:2000), WNT3A (rabbit, Abclonal, A0642, 1:2000), WNT10B (rabbit, Abclonal, A16717, 1:2000). 2.9 RT-qPCR Total RNA was obtained using the extract kit. Subsequently, the Ma"
},
{
"paper": "Dissolvable microneedles loaded ginsenoside Rg3 liposome a transdermal delivery approach for alopecia treatment",
"n_hits": 6,
"quote": "higher. Furthermore, quantitative character­ ization and transcriptome sequencing results showed that Rg3-MNs promoted hair regeneration by promoting the expression of Wnt3a and Wnt10b genes, activating the Wnt/β-catenin pathway. Therefore, Rg3-MNs present broad prospects in the treatment of alopeci"
}
],
"WNT3A": [
{
"paper": "Periplaneta americana extract (L.) promotes hair regrowth in Alopecia areata mice by reducing inflammation and modulating skin microbiota",
"n_hits": 11,
"quote": "iferation and hair growth in AA mice, reduced skin TNF-α, IL-23, and VCAM-1 expression. Transcriptomics and WB analysis indicated PA-011 downregulated inflammatory genes, activated Wnt3a, and modulated the TGF-β pathway. Metabolomics found PA-011 regulated metabolic pathways. 16S rRNA analysis showed"
},
{
"paper": "Curcumin-primed milk-derived extracellular vesicles remodel hair follicle microenvironment for the treatment of androgenetic alopecia",
"n_hits": 10,
"quote": "1224), all obtained from Proteintech Group, Inc.; Ki67 (GB121141), SOX9 (GB14171), IL-6 (GB11117), and TNF-α (GB11188), which were obtained from Servicebio Technology Co., Ltd; Wnt3a (DF6113) was purchased from Affinity Biosciences Group, Ltd. Isolation of mEVs AA was added to defatted bovine milk a"
},
{
"paper": "Exploring the Efficacy and Potential Mechanisms of Topical Periplaneta americana (L.) Extract in Treating Androgenetic Alopecia in a Mouse Model A Systems Pharmacology and Skin Microbiome Analysis",
"n_hits": 9,
"quote": "ology, PG212, Shanghai, China) were purchased from technology companies. The primary antibodies used included β-actin (mouse-derived, GB12001), Wnt7a (rabbit-derived, A14194), and Wnt3a (rabbit-derived, A0642) (Abclonal, Wuhan, China). Primers for genes GAPDH, Akt, Wnt7a, and β-catenin were synthesi"
},
{
"paper": "ISEV2025 Abstract Book.",
"n_hits": 9,
"quote": "man primary cells, suggesting a promising strategy against reducing ageing hallmarks in age-associated diseases, particularly those driven by accumulating senescent cells. PS1.153 WNT3A-loaded bi-layered microwell scaffolds enhance stemness and extracellular vesicle production in salivary gland stem"
}
],
"DKK1": [
{
"paper": "Involvement of DKK1 secreted from adiposederived stem cells in alopecia areata",
"n_hits": 220,
"quote": "O R I G I N A L A R T I C L E Involvement of DKK1 secreted from adipose-derived stem cells in alopecia areata Nahyun Choi1 | Juyeong Hwang1 | Doo Yeong Kim2 | Jino Kim3 | Seung Yong Song4 | Jong-Hyuk Sung1,2 1Epi Biotech Co., Ltd"
},
{
"paper": "Oxyresveratrol enhances hair regeneration in human dermal papilla cell and androgenetic alopecia mouse model",
"n_hits": 17,
"quote": "n, yielding a proliferation rate of 116.97 ± 8.58% compared to the control (P < 0.05; Fig. 1a). To elucidate the biological impact of ORV on HFDPC, the mRNA expression levels of DKK1 and β-catenin were analyzed using RT-PCR. Treatment with ORV at concentrations of 5 µg/ml and 10 µg/ml resulted in a "
},
{
"paper": "Stauntonia hexaphylla Extract Ameliorates Androgenic Alopecia by Inhibiting Androgen Signaling in Testosterone-induced Alopecia Mice",
"n_hits": 17,
"quote": "R) levels, apoptosis, and cell prolifer- ation in vitro and in vivo. In addition, paracrine factors for androgenic alopecia, such as transforming growth factor beta-1 (TGF-β1) and dickkopf-a (DKK-1), were examined. Apoptosis was investigated, and the evaluation of proliferation was examined with cyt"
},
{
"paper": "Black phosphorus nanosheets encapsulated microneedle for multifunctional therapy for androgenic alopecia",
"n_hits": 15,
"quote": "nced cellular uptake, and effectively modulated gene expression in dihydrotestosterone-treated human dermal papilla cells, downregulating negative regulators such as SRD5A2, AR, DKK1, and TGFB1, while upregulating positive regulators like CTNNBIP1 and VEGFA. Furthermore, we encapsulated BP-BA to MN "
}
],
"LEF1": [
{
"paper": "Cyclic alopecia in Msx2 mutants defects in hair cycling and hair shaft differentiation",
"n_hits": 18,
"quote": "Noggin abolishes hair filament differentiation but not that of the IRS (Kulessa et al., 2000). The Wnt signaling pathway is also implicated in hair follicle morphogenesis, with Lef1 constituting a key nuclear effector in this pathway (Zhou et al., 1995; DasGupta and Fuchs, 1999; Millar et al., 1999)"
},
{
"paper": "Gene therapy for alopecia in type II rickets model rats using vitamin D receptor-expressing adenovirus vector",
"n_hits": 12,
"quote": "Scale bar; 200 µm. 5 Vol.:(0123456789) Scientific Reports | (2023) 13:18528 | https://doi.org/10.1038/s41598-023-45594-2 www.nature.com/scientificreports/ Enhancement of Lef1 gene expression in VDRAdVinjected area of VdrKO rats In Vdr-KO rats, the expression of Lef1 (a Wnt signaling-related gene)"
},
{
"paper": "Molecular signatures and signaling interactions of the hair follicle stem cell niche.",
"n_hits": 12,
"quote": "labeling system that enabled high enrichment of these cell types from the skin during the telogen phase of the hair growth cycle (Figure 1b). We generated K14-H2BGFP;Crabp1-GFP;Lef1-RFP triple transgenic reporter mice and digested postnatal day P22 back skins to obtain single cells from epidermis an"
},
{
"paper": "Sulforaphane-Rich Broccoli Sprout Extract Promotes Hair Regrowth in an Androgenetic Alopecia Mouse Model via Enhanced Dihy drotestosterone Metabolism",
"n_hits": 9,
"quote": "this pathway in a testosterone-induced AGA mouse model, we Int. J. Mol. Sci. 2025, 26, 7467 15 of 33 analyzed the expression of β-catenin and lymphoid enhancer-binding factor 1 (Lef-1) in dorsal skin tissues using Western blot. Figure 6. In vivo activation of 3α-HSD enzymes in the liver 15 days post"
}
],
"LRP6": [
{
"paper": "Molecular signatures and signaling interactions of the hair follicle stem cell niche.",
"n_hits": 4,
"quote": "both HGSCs and BuSCs and known to regulate SC quiescence (Botchkarev et al., 2001, Kobielak et al., 2003). Wnt5a or Wnt6 interacting with Frizzled receptors, Fzd1, Fzd2 and Fzd7/Lrp6 co-receptors also play an important role in Wnt signaling crosstalk (Zeng et al., 2008). Less-well known interactions"
}
],
"SFRP1": [
{
"paper": "Molecular signatures and signaling interactions of the hair follicle stem cell niche.",
"n_hits": 10,
"quote": "upplementary Table S2). Finally, initial inspection of the signatures revealed a robust presence of previously known DP genes such as Corin, Enpp2, Hhip and Wif1, the BuSC genes Sfrp1 and Sox9, and the HGSC genes Shh and Msx2 (Figure 2g). Overall, our comprehensive transcriptome analysis in four dis"
},
{
"paper": "Exosomes Secreted from Adipose-Derived Stem Cells Are a Potential Treatment Agent for Immune-Mediated Alopecia",
"n_hits": 6,
"quote": "3A (P < 0:001) and AXIN2 (P < 0:0001) in both the ADSC-Exos and ADSC-Exos+MNX groups were significantly upregulated. LEF1 (P < 0:01) was upregulated in the ADSC-Exos+MNX group, and SFRP1 (P < 0:01) was downregulated in the ADSC-Exos group (Figure 6(d)). The top 30 KEGG enriched pathways of DEGs (P < "
},
{
"paper": "Kartogenin regulates hair growth and hair cycling",
"n_hits": 2,
"quote": "134(3):610-619. 3. Hawkshaw NJ, Hardman JA, Haslam IS, et al. Identifying novel strategies for treating human hair loss disorders: Cyclosporine A suppresses the Wnt inhibitor, SFRP1, in the dermal papilla of human scalp hair follicles PLoS Biol. May 2018;16(5):e2003705. 4. Naruse T, Aoki M, Fujimoto"
},
{
"paper": "Modified Huanjingjian Prevents Chemotherapy-Induced Alopecia by Inhibiting Genomic DNA Methylation of the Wnt Signaling Pathway in Mice",
"n_hits": 2,
"quote": "Powered by TCPDF (www.tcpdf.org) 42. Sunkara RR, Mehta D, Sarate RM, Waghmare SK. BMP-AKT-GSK3β signaling restores hair follicle stem cells decrease associated with loss of Sfrp1. Stem Cells. 2022;40(9):802817. doi:10.1093/stmcls/sxac041 43. Katoh M, Katoh M. CER1 is a common target of WNT and NODA"
}
],
"BMP4": [
{
"paper": "Cyclic alopecia in Msx2 mutants defects in hair cycling and hair shaft differentiation",
"n_hits": 10,
"quote": "uring the hair cycle, Msx2 deficiency shortens anagen phase, but prolongs catagen and telogen. Msx2-deficient hair shafts are structurally abnormal. Molecular analyses suggest a Bmp4/Bmp2/Msx2/Foxn1 acidic hair keratin pathway is involved. These structurally abnormal hairs are easily dislodged in ca"
},
{
"paper": "Secretory phospholipase A2-IIA overexpressing mice exhibit cyclic alopecia mediated through aberrant hair shaft differentiation and impaired wound healing response",
"n_hits": 7,
"quote": "ecursor cells in K14-sPLA2-IIA homozygous mice (Fig. 4d). To understand the molecular mech- anisms underlying impaired differentiation of the matrix cells, we checked the level of BMP4, Shh and Lef1, which are known to regulate the matrix cells proliferation and generation of precursors for IRS and "
},
{
"paper": "Overexpression of MYB in the skin induces alopecia and epidermal hyperplasia",
"n_hits": 4,
"quote": "and Lce3) or hornerin (Hrnr) (Fig. 5a and Table S2). Interestingly, multiple genes, including transcription factors, that control hair follicle differentiation (e.g. Msx2, Bmp2, Bmp4, Foxn1, Efl5, Hoxc13 and Lhx2) were found downregulated in the skin of K5-Myb mice (Figs. 5a and Table S2). Quantitat"
},
{
"paper": "Alopecia in a Viable Phospholipase C Delta 1 and Phospholipase C Delta 3 Double Mutant",
"n_hits": 3,
"quote": "13, showed unaltered expression between wild-type and oltSH and oltNH mutants. The expression levels of genes encoding for secreted signalling proteins Pdgfa, Pdgfb, Shh, Bmp2 and Bmp4 were also unchanged (Figure 10) [7581]. However, Krtap12-1 (in the hair cuticle) and Crisp1 (in the hair medulla) "
}
],
"BMP2": [
{
"paper": "ISEV2025 Abstract Book.",
"n_hits": 11,
"quote": "for bone regeneration. Methods: Human bone marrow-derived stromal cells (hBM- SCs) microtissues were differentiated in chondrogenic medium with/without bone morphogenic protein 2 (BMP2) for 21 days. Following this, constructs were either maintained in chondro- genic medium or switched to hypertrophi"
},
{
"paper": "Low-frequency electromagnetic fields ameliorate testosterone-induced androgenetic alopecia in mice through LncRNA H19 miR-214-5p β-catenin signal pathway",
"n_hits": 5,
"quote": "d invasion under hypoxic conditions [14]. Similar to this, H19 promotes the dif­ ferentiation of human bone marrow mesenchymal stem cells (hBMMSCs) by controlling the miR-214-5p/BMP2 axis during osteo­ blastic differentiation [15]. These findings underscore the capacity of lncRNA H19 to modulate miR"
},
{
"paper": "Overexpression of MYB in the skin induces alopecia and epidermal hyperplasia",
"n_hits": 4,
"quote": "(Lce1 and Lce3) or hornerin (Hrnr) (Fig. 5a and Table S2). Interestingly, multiple genes, including transcription factors, that control hair follicle differentiation (e.g. Msx2, Bmp2, Bmp4, Foxn1, Efl5, Hoxc13 and Lhx2) were found downregulated in the skin of K5-Myb mice (Figs. 5a and Table S2). Qua"
},
{
"paper": "Alopecia in a Viable Phospholipase C Delta 1 and Phospholipase C Delta 3 Double Mutant",
"n_hits": 3,
"quote": "and Hoxc13, showed unaltered expression between wild-type and oltSH and oltNH mutants. The expression levels of genes encoding for secreted signalling proteins Pdgfa, Pdgfb, Shh, Bmp2 and Bmp4 were also unchanged (Figure 10) [7581]. However, Krtap12-1 (in the hair cuticle) and Crisp1 (in the hair m"
}
],
"NOG": [
{
"paper": "Cyclic alopecia in Msx2 mutants defects in hair cycling and hair shaft differentiation",
"n_hits": 5,
"quote": "ification and differentiation of matrix cells into hair shaft and sheath cells. BMP signaling is required during hair differentiation, as attenuation of BMP signaling by ectopic Noggin abolishes hair filament differentiation but not that of the IRS (Kulessa et al., 2000). The Wnt signaling pathway i"
},
{
"paper": "Secretory phospholipase A2-IIA overexpressing mice exhibit cyclic alopecia mediated through aberrant hair shaft differentiation and impaired wound healing response",
"n_hits": 2,
"quote": "Smad4 resulted in hyperplasia of interfollicular epidermis (IFE) and sebaceous glands (SGs), that leads to exhaustion of the SC niche and progressive hair loss26. Expression of noggin in epidermis resulted in upregulated Wnt signalling with epidermal hyperplasia, progressive hair loss, and formation"
}
],
"MSX2": [
{
"paper": "Cyclic alopecia in Msx2 mutants defects in hair cycling and hair shaft differentiation",
"n_hits": 159,
"quote": "Cyclic alopecia in Msx2 mutants: defects in hair cycling and hair shaft differentiation Liang Ma1,2, Jian Liu3, Tobey Wu3, Maksim Plikus3, Ting-Xin Jiang3, Qun Bi2, Yi-Hsin Liu4, Sven Müller-Röver5, He"
},
{
"paper": "Secretory phospholipase A2-IIA overexpressing mice exhibit cyclic alopecia mediated through aberrant hair shaft differentiation and impaired wound healing response",
"n_hits": 10,
"quote": "tly, sPLA2-IIA overexpression affects the hair shaft differentiation leading to development of cyclic alopecia. Molecular investigation study showed aberrant expression of Sox21, Msx2 and signalling modulators necessary for proper differentiation of inner root sheath (IRS) and hair shaft formation. "
},
{
"paper": "Overexpression of MYB in the skin induces alopecia and epidermal hyperplasia",
"n_hits": 6,
"quote": "genes (Lce1 and Lce3) or hornerin (Hrnr) (Fig. 5a and Table S2). Interestingly, multiple genes, including transcription factors, that control hair follicle differentiation (e.g. Msx2, Bmp2, Bmp4, Foxn1, Efl5, Hoxc13 and Lhx2) were found downregulated in the skin of K5-Myb mice (Figs. 5a and Table S2"
},
{
"paper": "Alopecia in a Viable Phospholipase C Delta 1 and Phospholipase C Delta 3 Double Mutant",
"n_hits": 3,
"quote": ") [59 63]. Three important transcription factors involved in the transcription of hair keratin and keratin associated protein encoding genes in mice and humans [51,6474], Foxn1, Msx2 and Hoxc13, showed unaltered expression between wild-type and oltSH and oltNH mutants. The expression levels of gen"
}
],
"SHH": [
{
"paper": "Mice with a Targeted Mutation of Patched2 Are Viable but Develop Alopecia and Epidermal Hyperplasia†",
"n_hits": 60,
"quote": "splicing appears to affect mostly the C-terminal region and the sterol- sensing domain (52). Biochemical studies revealed that human PTCH1 and PTCH2 bind to all Hh family members (Sonic hedgehog, Desert hedgehog [Dhh], and Indian hedgehog [Ihh]) with sim- ilar affinities (14). Since Ptc2 is highly ex"
},
{
"paper": "Disrupted cholesterol biosynthesis and hair follicle stem cell impairment in the onset of alopecia",
"n_hits": 16,
"quote": "sappearance of the hair follicles [14]. Hair follicle stem cell regeneration depends on a complex network orchestrated by multiple pathways, including the Wnt/β-catenin pathway, Sonic hedgehog (Shh) pathway, Notch pathway, BMP (bone morphogenetic proteins) pathway, and apoptotic pathway. Among these"
},
{
"paper": "ISEV2025 Abstract Book.",
"n_hits": 13,
"quote": "GA n◦ 101079264). PS2.952 PI3K/Rab signalling regionally and conditionally regulates large exosome biogenesis Shuo Wang, Yosuke Tanaka The University of Tokyo, Japan Introduction: Sonic hedgehog (SHH)-containing large exo- somes are a new type of large EVs. They may be equivalent to ART-EVs that c"
},
{
"paper": "Molecular signatures and signaling interactions of the hair follicle stem cell niche.",
"n_hits": 12,
"quote": "Acad Sci U S A 2000;97(25):138249. [PubMed: 11087819] Sato N, Leopold PL, Crystal RG. Induction of the hair growth phase in postnatal mice by localized transient expression of Sonic hedgehog. J Clin Invest 1999;104(7):85564. [PubMed: 10510326] Schneider MR, Schmidt-Ullrich R, Paus R. The hair foll"
}
],
"GLI1": [
{
"paper": "Mice with a Targeted Mutation of Patched2 Are Viable but Develop Alopecia and Epidermal Hyperplasia†",
"n_hits": 46,
"quote": "AAA GGTCTGTTCC-3\u0003), GAPDH-F (5\u0003-GTGGCAAAGTGGAGATTGTTGCC-3\u0003), GAPDH-R (5\u0003-GATGATGACCCGTTTGGCTCC-3\u0003), Ptc1-F (5\u0003-AACAAAA ATTCAACCAAACCTC-3\u0003), Ptc1-R (5\u0003-TGTCTTCATTCCAGTTGATGTG- 3\u0003), Gli1-F (5\u0003-TTCGTGTGCCATTGGGGAGG-3\u0003), and Gli1-R (5\u0003-CTTGG GCTCCACTGTGGAGA-3\u0003). Reaction conditions are available upon re"
},
{
"paper": "Multi-layered environmental regulation on the homeostasis of stem cells The saga of hair growth and alopecia",
"n_hits": 4,
"quote": "steum [52]. 5.3. Nervous system The nervous system also plays an important role in defining properties of the hair stem cell niche. Neuronal Sonic Hedgehog (Shh) signals to induce Gli1 in neighboring cells to create a perineural stem cell niche within the telogen bulge. Gli1 positive follicle cells "
},
{
"paper": "Ox40-Cremediated deletion of BRD4 reveals an unexpected phenotype of hair follicle stem cells in alopecia",
"n_hits": 4,
"quote": "cle stem cells (27), and we found that some lineage transcription factors (Lhx2, Nfib, Sox9, Dlx3) and key signaling factors (Lef1, Frfr2, Id1, Lgr4 for Wnt pathway; Gas1, Hes1, Gli1, ptch2 for SHH pathway; Cdk4, Ccne1, Aurkb for cell cycling) that are known to regulate follicle stem cells showed ex"
}
],
"PTCH1": [
{
"paper": "Mice with a Targeted Mutation of Patched2 Are Viable but Develop Alopecia and Epidermal Hyperplasia†",
"n_hits": 34,
"quote": "). Ptc1 mutations also occur in sporadic forms of BCC and MB. Mutational studies with mice have verified that Ptc1 is a tumor suppressor. We previously identified a second mammalian Patched gene, Ptc2, and demonstrated its distinct expression pattern during embryogenesis, suggesting a unique role in d"
},
{
"paper": "Skin cancer understanding the journey of transformation from conventional to advanced treatment approaches.",
"n_hits": 10,
"quote": "unity not able to cope with the cancer- inducing agents, (iii) beta human papilloma virus (HPV) and (iv) Human immunodeficiency virus (HIV) [51]. Cell growth is regulated by the patched/hedgehog intracel- lular signaling system, and continuous activation of this pathway results in the formation of B"
},
{
"paper": "Molecular signatures and signaling interactions of the hair follicle stem cell niche.",
"n_hits": 6,
"quote": "h→Hhip, which inhibits Hedgehog signaling by SHH sequestering (Griffiths et al., 2021). Conversely, in a Shh→Gpc5 interaction, Gpc5 may promote Hedgehog signaling by stabilizing Ptch1 binding (Li et al., 2011). Potential interaction calls from DP to BuSCs included all four R- spondins, highly expres"
},
{
"paper": "Ox40-Cremediated deletion of BRD4 reveals an unexpected phenotype of hair follicle stem cells in alopecia",
"n_hits": 2,
"quote": "CAGTC CACAGTCTTGTCAATCTTGGCA Cdca2 CGAGTTCACACGACAAGCCT GGAGTCACAAACGGTTCAGTTC Cdk4 ATGGCTGCCACTCGATATGAA TCCTCCATTAGGAACTCTCACAC Ccnd1 GCGTACCCTGACACCAATCTC CTCCTCTTCGCACTTCTGCTC Ptch1 AAAGAACTGCGGAAGTTTTTG CTTCTCCTATCTTCTGACGGGT Gas1 CCATCTGCGAATCGGTCAAAG GCTCGTCGTCATATTCTTCGTC Gli1 CCAAGCCAACTTTA"
}
],
"JAK1": [
{
"paper": "Selective Janus kinase 1 inhibition resolves inflammation and restores hair growth offering a viable treatment option for alopecia areata",
"n_hits": 112,
"quote": "at ranges close to a questionable risk profile. Objectives: We explored the possibility to separate the beneficial and adverse effects of JAK inhibition by selectively inhibiting JAK1 and thereby avoiding side effects associated with JAK2 blockade. Methods: The C3H/HeJ mouse model of AA was used to "
},
{
"paper": "Selective inhibition of JAK3 signaling is sufficient to reverse alopecia areata",
"n_hits": 62,
"quote": "(1012). AA is characterized by dysregulation of JAK/STAT activity, in particular, the γc cytokine and IFN-γ signaling pathway (3, 4). Our lab recently pioneered the use of the JAK1/2 inhibitor ruxolitinib and baricitinib, as well as the pan-JAK inhibitor, tofacitinib, in the treatment of human AA ("
},
{
"paper": "Induction of T cell exhaustion by JAK1 3 inhibition in the treatment of alopecia areata",
"n_hits": 47,
"quote": "Induction of T cell exhaustion by JAK1/3 inhibition in the treatment of alopecia areata Zhenpeng Dai 1, Tanya Sezin 1, Yuqian Chang 1, Eunice Y. Lee 1, Eddy Hsi Chun Wang 1 and Angela M. Christiano 1,2* 1Department of"
},
{
"paper": "JAK-STAT1 as therapeutic target for EGFR deficiency-associated inflammation and scarring alopecia",
"n_hits": 39,
"quote": "synergistically with interferon gamma expressing CD8 T-cell and NK-cell-mediated inflammation, com- promised the stem cell niche. Hair follicle-specific genetic depletion of either JAK1/2 or STAT1 or therapeutic inhibition of JAK1/2 ameliorated the inflammation, restored skin barrier function and activ"
}
],
"JAK2": [
{
"paper": "Selective inhibition of JAK3 signaling is sufficient to reverse alopecia areata",
"n_hits": 33,
"quote": "JAK1/2 inhibitor ruxolitinib and baricitinib, as well as the pan-JAK inhibitor, tofacitinib, in the treatment of human AA (3, 1315). However, the relative contribution of JAK1, JAK2, and JAK3 inhibition to the therapeutic benefit of ruxolitinib, baricitinib, and tofacitinib in AA has not been inves"
},
{
"paper": "Selective Janus kinase 1 inhibition resolves inflammation and restores hair growth offering a viable treatment option for alopecia areata",
"n_hits": 14,
"quote": "ives: We explored the possibility to separate the beneficial and adverse effects of JAK inhibition by selectively inhibiting JAK1 and thereby avoiding side effects associated with JAK2 blockade. Methods: The C3H/HeJ mouse model of AA was used to demonstrate therapeutic efficacy in vivo with differen"
},
{
"paper": "Mesenchymal Stem Cell Therapy in Alopecia Areata Visual and Molecular Evidence from a Mouse Model",
"n_hits": 10,
"quote": "visually and through tissue analysis. The MSC-treated group showed more hair regrowth compared to the control (CTL) group. MSCT notably reduced local inflammatory cytokines (JAK1, JAK2, STAT1, STAT3, IFN-γR, IL-1β, IL-16, IL-17α, and IL-18) in AA-induced mices skin, but systemic cytokine levels rem"
},
{
"paper": "JAK-STAT1 as therapeutic target for EGFR deficiency-associated inflammation and scarring alopecia",
"n_hits": 9,
"quote": "igen presentation WT Psmb10 Psmb8 Psmb9 Rpn1 Rpn2 Hspd1 Hspe1 Immunoproteasome -1 0 1 Osmr Il10rb Il11ra1 Il11ra2 Il13ra1 Il20rb Il4ra Il6ra Il6st Ifngr1 Ifngr2 Ifnar1 Ifnar2 Jak1 Jak2 Jak3 Tyk2 Stat1 Stat3 Stat4 Stat5a Stat5b Ifi214 Ifi47 Ifitm3 Socs3 JAK-STAT Pathway 0 20 40 60 80 ** **** ** **** "
}
],
"JAK3": [
{
"paper": "Selective inhibition of JAK3 signaling is sufficient to reverse alopecia areata",
"n_hits": 65,
"quote": "Accepted: February 25, 2021 Published: April 8, 2021 Reference information: JCI Insight. 2021;6(7):e142205. https://doi.org/10.1172/jci. insight.142205. Selective inhibition of JAK3 signaling is sufficient to reverse alopecia areata Zhenpeng Dai,1 James Chen,1 Yuqian Chang,1 and Angela M. Christiano"
},
{
"paper": "Induction of T cell exhaustion by JAK1 3 inhibition in the treatment of alopecia areata",
"n_hits": 17,
"quote": "tly restored hair regrowth in the C3H/HeJ mouse model and in patients with AA (7, 1214). Signaling through the six gc cytokines (IL-2, IL-4, IL-7, IL-9, IL-15 and IL-21) requires JAK3 binding to the gc present in the receptor complexes for all six cytokines, as well as JAK1 binding to the other cha"
},
{
"paper": "Selective Janus kinase 1 inhibition resolves inflammation and restores hair growth offering a viable treatment option for alopecia areata",
"n_hits": 12,
"quote": "ncreased risk of respiratory infections due to the immunosuppressive effects following long term use. The safety profile for Baricitinib (10 and 100fold selectivity over TYK2 and JAK3, respectively30) in AA was recently presented to be similar to that found in RA and AD31 (Press release https://inv"
},
{
"paper": "Hydrogel forming microneedles loaded with VEGF and Ritlecitinib,polyhydroxyalkanoates nanoparticles for mini-invasive androgenetic alopecia treatment",
"n_hits": 5,
"quote": "esis, Goldman demonstrated that VEGF expression was significantly reduced in alopecic follicles compared to normal human hair follicles [28,29]. Ritlecitinib is an inhibitor of JAK3 and TEC kinases, blocking γ common chain cytokine signaling and inhibiting CD8+ T cells and natural killer cells (thes"
}
],
"TYK2": [
{
"paper": "Selective Janus kinase 1 inhibition resolves inflammation and restores hair growth offering a viable treatment option for alopecia areata",
"n_hits": 12,
"quote": "scribed increased risk of respiratory infections due to the immunosuppressive effects following long term use. The safety profile for Baricitinib (10 and 100fold selectivity over TYK2 and JAK3, respectively30) in AA was recently presented to be similar to that found in RA and AD31 (Press release ht"
},
{
"paper": "JAK-centric explainable few-shot gene-expression diagnosis framework for alopecia via MultiPLIER priors and relation-style set-to-set comparison.",
"n_hits": 10,
"quote": "s, a Comprehensive differential expression analysis of key genes was conducted in the AGA dataset. Particular emphasis was placed on the JAK family genes (JAK1, JAK2, JAK3, and TYK2), then the differential expression of these genes in AGA was analyzed to clarify their potential mechanisms in this di"
},
{
"paper": "Selective inhibition of JAK3 signaling is sufficient to reverse alopecia areata",
"n_hits": 8,
"quote": "d that INCB039110 and PF-06651600 (but not CEP- 33779) robustly inhibited this response (Figure 1, A and B). Next, we used IL-10 to induce STAT3 tyrosine phosphorylation via JAK1/TYK2 and found that it was specifically inhibited by INCB039110 (Figure 1C). In primary mouse macrophages, we observed th"
},
{
"paper": "JAK-STAT1 as therapeutic target for EGFR deficiency-associated inflammation and scarring alopecia",
"n_hits": 2,
"quote": "ntation WT Psmb10 Psmb8 Psmb9 Rpn1 Rpn2 Hspd1 Hspe1 Immunoproteasome -1 0 1 Osmr Il10rb Il11ra1 Il11ra2 Il13ra1 Il20rb Il4ra Il6ra Il6st Ifngr1 Ifngr2 Ifnar1 Ifnar2 Jak1 Jak2 Jak3 Tyk2 Stat1 Stat3 Stat4 Stat5a Stat5b Ifi214 Ifi47 Ifitm3 Socs3 JAK-STAT Pathway 0 20 40 60 80 ** **** ** **** **** *** *"
}
],
"STAT1": [
{
"paper": "JAK-STAT1 as therapeutic target for EGFR deficiency-associated inflammation and scarring alopecia",
"n_hits": 88,
"quote": "Article JAK-STAT1 as therapeutic target for EGFR deficiency-associated inflammation and scarring alopecia Karoline Strobl1, Jörg Klufa1, Regina Jin 1, Lena Artner-Gent 1, Dana Krauß 1, Philipp Novosz"
},
{
"paper": "Mesenchymal Stem Cell Therapy in Alopecia Areata Visual and Molecular Evidence from a Mouse Model",
"n_hits": 10,
"quote": "ly and through tissue analysis. The MSC-treated group showed more hair regrowth compared to the control (CTL) group. MSCT notably reduced local inflammatory cytokines (JAK1, JAK2, STAT1, STAT3, IFN-γR, IL-1β, IL-16, IL-17α, and IL-18) in AA-induced mices skin, but systemic cytokine levels remained "
},
{
"paper": "Selective inhibition of JAK3 signaling is sufficient to reverse alopecia areata",
"n_hits": 8,
"quote": "use macrophages, we observed that only CEP-33779 (but not INCB039110 or PF-06651600) inhibited JAK2-dependent GM-CSF signaling (Figure 1D). IFN-γ signaling through JAK1/2-induced STAT1 tyrosine phosphorylation, which was inhibited by INCB039110 or CEP-33779 (but not by PF-06651600) (Figure 1E). Fina"
},
{
"paper": "Selective Janus kinase 1 inhibition resolves inflammation and restores hair growth offering a viable treatment option for alopecia areata",
"n_hits": 7,
"quote": "eo/query/ acc.cgi?acc=GSE94235) and GSE94236 (mouse skin samples) (https://www.ncbi.nlm.nih.gov/geo/query/acc. cgi?acc=GSE94236). 2.4.6 | ALADIN scores IFN (Cxcl9, Cxcl10, Cxcl11, Stat1, and Mx1) and CTL (Cd8a, Gzmb, Icos, Prf1) ALADIN scores for the Taq- man data were calculated for each group as d"
}
],
"STAT3": [
{
"paper": "Reversal of alopecia areata, osteoporosis follow treatment with activation of Tgr5 in mice",
"n_hits": 20,
"quote": "he appearance of alopecia areata and bone microstructure has improved. Immunohistochemistry and qPCR analysis showed that activation of Tgr5 can down-regulate the express of JAK1, STAT3, IL-6, TNF-α, and VEGF. Conclusion: These findings indicate that activation of Tgr5 mediated amelioration of alope"
},
{
"paper": "CXCL12 Neutralizing Antibody Promotes Hair Growth in Androgenic Alopecia and Alopecia Areata",
"n_hits": 16,
"quote": "f AA and reduced the number of CD8+ cells. Interferon-γ (IFNγ) treatment increased the secretion of CXCL12 from DFs through the signal transducer and activator of transcription 3 (STAT3) pathway, and αCXCL12 treatment protected the hair follicle from IFNγ in hair organ culture. Collectively, these r"
},
{
"paper": "Involvement of DKK1 secreted from adiposederived stem cells in alopecia areata",
"n_hits": 15,
"quote": "alopecia areata (AA), a condition characterised by significant increases in the DKK1 levels in human and mouse ASCs. Treatment of interferon-γ increased the expression of DKK1 via STAT3 phosphoryla- tion in ASCs. Treatment with recombinant DKK1 resulted in a decrease of cell growth in outer root she"
},
{
"paper": "Modulating immune responses in alopecia therapeutic insights and potential targets of antisense oligonucleotides",
"n_hits": 13,
"quote": "hibition promotes the production of Th1 cytokines and chemokines, impairing inflammation, while SIRT1 activation suppresses autoreactive responses through NF-κB deacetylation and STAT3 phosphorylation. Additionally, antisense oligonucleotides (ASOs) targeting miR-485-3p show therapeutic potential in"
}
],
"STAT5A": [
{
"paper": "Induction of T cell exhaustion by JAK1 3 inhibition in the treatment of alopecia areata",
"n_hits": 8,
"quote": "STAT signaling in mouse T cells by treatment with Ifidancitinib. We found that treatment of mouse T cells with Ifidancitinib over a range of doses strongly inhibited IL-2-stimulated STAT5 phosphorylation (Figure 1A). Ifidancitinib also exhibited potent inhibitory effects on JAK1/2-mediated IFN-g signal"
},
{
"paper": "Selective Janus kinase 1 inhibition resolves inflammation and restores hair growth offering a viable treatment option for alopecia areata",
"n_hits": 5,
"quote": "sur- vival signals between CD8+ T cells residing at the two sites. Long term survival of memory CD8+ T cells is dependent on IL15 and IL7, both of which signal via JAK1/JAK3 and STAT5 to induce antiapoptotic mole- cules such as Bcl2 or BclXL.6163 Blocking IL15RB has been shown to be efficient "
},
{
"paper": "Blockade of IL-7 signaling suppresses inflammatory responses and reverses alopecia areata in C3H HeJ mice",
"n_hits": 4,
"quote": "l control scalp skin (Fig. 1, E and F). We investigated the effects of IL-7mediated signaling in skin-­ infiltrating T cells. Signal transducer and activator of transcription 5 (STAT5) is a key transcription factor downstream of IL-7R, and IL-7 requires STAT5 to induce Bcl-2 expression and to main"
},
{
"paper": "Skin cancer understanding the journey of transformation from conventional to advanced treatment approaches.",
"n_hits": 4,
"quote": "pathway that is directly connected to the family of proteins called JAK (Janus Kinase) which is involved in the integration of different signaling path- ways signals. STAT3 and STAT5 are majorly involved in the progression of cancer while STAT1 plays a crucial role in tumor suppression. Chronic inf"
}
],
"IL15": [
{
"paper": "Induction of T cell exhaustion by JAK1 3 inhibition in the treatment of alopecia areata",
"n_hits": 12,
"quote": "hogenesis of AA is also associated with the overexpression of cytokines, including interferon gamma (IFN-g) and the common gamma chain (gc) cytokines interleukin (IL)-2, IL-7, and IL-15, which promote the activity of alopecic T lymphocytes in affected skin (3, 4, 7). The IFN-g and gc cytokines signa"
},
{
"paper": "Selective inhibition of JAK3 signaling is sufficient to reverse alopecia areata",
"n_hits": 10,
"quote": "JAK3i) with various cytokines (Supplemental Table 1; supplemental material available online with this article; https://doi.org/10.1172/jci.insight.142205DS1). We tested IL-7 and IL-15, which signal through JAK1/3 and lead to STAT5 tyrosine phosphorylation, and found that INCB039110 and PF-06651600 ("
},
{
"paper": "Mesenchymal Stem Cell Therapy in Alopecia Areata Visual and Molecular Evidence from a Mouse Model",
"n_hits": 8,
"quote": "nduction of AA and also did not receive any treatment. We examined the mRNA expression of immune-related cytokines, including JAK1, JAK2, STAT1, STAT3, IFN-γR, IL-1β, IL-6, IL-10, IL-15, IL-17α, IL-18, and IL-22 (Figure 4). In the AA-induced CTL mice, JAK1, JAK2, STAT1, STAT3, IFN-γR, IL-1β, IL-10, "
},
{
"paper": "Blockade of IL-7 signaling suppresses inflammatory responses and reverses alopecia areata in C3H HeJ mice",
"n_hits": 6,
"quote": "gation of the cyto- kines that drive their activation and function (5, 6). Our transcrip- tional profiling analysis revealed that the c cytokines interleukin-2 (IL-2), IL-7, and IL-15 were up-regulated in lesional skin from both humans and C3H/HeJ mice with AA (6). Blockade of either of IL-2 or IL-"
}
],
"IFNG": [
{
"paper": "Induction of alopecia areata in C3H HeJ mice using polyinosinic-polycytidylic acid (poly[IC]) and interferon-gamma",
"n_hits": 90,
"quote": "8) 8:12518 | DOI:10.1038/s41598-018-30997-3 www.nature.com/scientificreports Induction of alopecia areata in C3H/HeJ mice using polyinosinic- polycytidylic acid (poly[I:C]) and interferon-gamma Jung-Min Shin1, Dae-Kyoung Choi2, Kyung-Cheol Sohn1, Jung-Woo Koh1, Young Ho Lee3, Young-Joon Seo1, Chang "
},
{
"paper": "SOCS3 treatment prevents the development of alopecia areata by inhibiting CD8+ T cell-mediated autoimmune destruction",
"n_hits": 64,
"quote": ", China 2Department of Plastic Surgery, Shanghai International Medical Center, Shanghai, China Correspondence to: Wei Wu, email: babevivi@126.com Keywords: alopecia areata, SOCS3, IFN-γ, autoimmune, hair follicle Received: October 02, 2016 Accepted: February 23, 2017 Published: March 23, 2017 Copyri"
},
{
"paper": "CXCR3 Blockade Inhibits T-cell Migration into the Skin and Prevents Development of Alopecia Areata",
"n_hits": 45,
"quote": "New York, NY, 10032, USA Abstract Alopecia areata (AA) is an autoimmune disease of the hair follicle (HF) that results in hair loss of varying severity. Recently, we showed that IFN-γ-producing NKG2D+CD8+ T cells actively infiltrate the HF, and are responsible for its destruction in C3H/HeJ AA mice."
},
{
"paper": "Selective inhibition of JAK3 signaling is sufficient to reverse alopecia areata",
"n_hits": 39,
"quote": "mulate in the skin and contribute to HF destruction (4, 5). The pathogenesis of AA is also associated with the overexpression of proinflammatory cytokines, such as interferon-γ (IFN-γ) and common γ chain (γc) cytokines, which break down HF immune privilege and promote the survival and function of cy"
}
],
"CXCL10": [
{
"paper": "CXCR3 Blockade Inhibits T-cell Migration into the Skin and Prevents Development of Alopecia Areata",
"n_hits": 67,
"quote": "o involved in a wide range of disease processes, including infection, autoimmune, inflammatory, and malignant diseases (1214). The CXCR3 receptor and its cognate ligands, CXCL9, CXCL10 and CXCL11 have been implicated in directing a Th1 inflammatory response (1518). Recent studies support the notio"
},
{
"paper": "Modulating immune responses in alopecia therapeutic insights and potential targets of antisense oligonucleotides",
"n_hits": 14,
"quote": "ized by sudden hair loss, with interferon-gamma (IFN-γ) playing a pivotal role in pathogenesis. The upregulation of IFN response genes, including IFN-inducible chemokines CXCL9, CXCL10, and CXCL11, in lesional skin reflects the activation of the IFN response pathway and contributes to immune cell re"
},
{
"paper": "Induction of alopecia areata in C3H HeJ mice using polyinosinic-polycytidylic acid (poly[IC]) and interferon-gamma",
"n_hits": 8,
"quote": "the AA lesions revealed increased infiltration of CD4+ and CD8+ cells infiltration around the hair follicles. IFNγ and poly(I:C) increased the expression of NLRP3, IL-1β, CXCL9, CXCL10, and CXCL11 in mouse skin. Taken together, these findings indicate a shorter and more convenient means of AA animal"
},
{
"paper": "ISEV2025 Abstract Book.",
"n_hits": 7,
"quote": "itochon- drial fragmentation, fostering a more interconnected mitochon- drial network. Notably, they also significantly lowered the levels of key inflammatory mediators, including CXCL10, IL-18, and IL-4. Summary/Conclusion: These findings highlight PDNVs as potential modulators of mitochondrial dyn"
}
],
"CXCR3": [
{
"paper": "CXCR3 Blockade Inhibits T-cell Migration into the Skin and Prevents Development of Alopecia Areata",
"n_hits": 179,
"quote": "CXCR3 Blockade Inhibits T-cell Migration into the Skin and Prevents Development of Alopecia Areata Zhenpeng Dai*, Luzhou Xing‖, Jane Cerise*, Eddy Hsi Chun Wang*, Ali Jabbari*, Annemie"
},
{
"paper": "Immunoregulatory Effects of Myeloid-Derived Suppressor Cell Exosomes in Mouse Model of Autoimmune Alopecia Areata",
"n_hits": 4,
"quote": "ion did not differ between the two MDSC preparations (Figure 1C). Myeloid-derived suppressor cells migrate from the BM toward inflamed organs, which involves predominantly CCR7, CXCR3, and CXCR4. Chemokine receptor expression differed between ex vivo sorted and culture-derived MDSC with CCR5, CCR7, "
},
{
"paper": "Blockade of IL-7 signaling suppresses inflammatory responses and reverses alopecia areata in C3H HeJ mice",
"n_hits": 3,
"quote": "orts in other mouse models (20, 21), IL-7c increased the total number of lymphocytes in lymphoid organs (fig. S3A). We also found that IL-7c robustly increased the frequency of CXCR3+CD8+ T cells, T-bet+CD8+ T cells, and IFN-producing CD8+ T cells in SDLNs (Fig. 2I and fig. S3B) but only slightly "
},
{
"paper": "Selective inhibition of JAK3 signaling is sufficient to reverse alopecia areata",
"n_hits": 3,
"quote": "rimers. 2017;3:17011. 4. Xing L, et al. Alopecia areata is driven by cytotoxic T lymphocytes and is reversed by JAK inhibition. Nat Med. 2014;20(9):10431049. 5. Dai Z, et al. CXCR3 blockade inhibits T cell migration into the skin and prevents development of alopecia areata. J Immunol. 2016;197(4):1"
}
],
"IL7R": [
{
"paper": "Blockade of IL-7 signaling suppresses inflammatory responses and reverses alopecia areata in C3H HeJ mice",
"n_hits": 146,
"quote": "Dai et al., Sci. Adv. 2021; 7 : eabd1866 2 April 2021 SCIE N C E A D V A NCES | RESEA R CH A RT ICL E 1 of 13 I M MUNOLOGY Blockade of IL-7 signaling suppresses inflammatory responses and reverses alopecia areata in C3H/HeJ mice Zhenpeng Dai1, Eddy Hsi Chun Wang1, Lynn Petukhova1, Yuqian Chang1, Eun"
},
{
"paper": "Selective inhibition of JAK3 signaling is sufficient to reverse alopecia areata",
"n_hits": 4,
"quote": "6651600 (JAK3i) with various cytokines (Supplemental Table 1; supplemental material available online with this article; https://doi.org/10.1172/jci.insight.142205DS1). We tested IL-7 and IL-15, which signal through JAK1/3 and lead to STAT5 tyrosine phosphorylation, and found that INCB039110 and PF-0"
},
{
"paper": "Extracellular vesicles in age-related diseases disease pathogenesis, intervention, and biomarker.",
"n_hits": 2,
"quote": "types of occupation, types of sports, and previous injury, also contribute to initiation, promotion and progression of OA [145]. Pro-inflamma- tory cytokines such as IL-1, IL-6, IL-7, IL-8, IL-17, IL-18, IL-20, IL-36, MCP-2, MIF, MIG, oncostatin M, bFGF, TGFα, S100 proteins, are found in OA joints, "
},
{
"paper": "Hair follicle-derived mesenchymal stem cells decrease alopecia areata mouse hair loss and reduce inflammation around the hair follicle",
"n_hits": 2,
"quote": "ion [39], which indicated significant treatment in androgenic alopecia patients. But clinical studies for AA therapy are limited. The preclinical study indicated that short-term IL-7 receptors in combination with low doses of Treg-tropic cytokines increased therapeutic effects in AA treatment [40]. "
}
],
"TBX21": [
{
"paper": "Controlled Delivery of T-box21 Small Interfering RNA Ameliorates Autoimmune Alopecia (Alopecia Areata) in a C3H HeJ Mouse Model",
"n_hits": 120,
"quote": "using cationized gelatin8 as a new therapeutic approach, targeting T- box21 gene (Tbx21) to repress the expression of inter- feron-\u0001 gene (Ifng). Tbx21 gene was formerly known as T-bet gene and plays an important role in control of the Ifng gene expression and Th1 cell differentiation and function.9"
},
{
"paper": "The C3H HeJ mouse and DEBR rat models for alopecia areata review of preclinical drug screening approaches and results",
"n_hits": 27,
"quote": "mouse recombinant IL4 were given daily for 3 weeks which significantly restored hair growth which persisted during the 2 month observation period (18). Gene therapy with T-box 21 (Tbx21) T-box 21 is a transcription factor involved in Th1 differentiation, the dominant immunological process in AA as m"
},
{
"paper": "Blockade of IL-7 signaling suppresses inflammatory responses and reverses alopecia areata in C3H HeJ mice",
"n_hits": 4,
"quote": "models (20, 21), IL-7c increased the total number of lymphocytes in lymphoid organs (fig. S3A). We also found that IL-7c robustly increased the frequency of CXCR3+CD8+ T cells, T-bet+CD8+ T cells, and IFN-producing CD8+ T cells in SDLNs (Fig. 2I and fig. S3B) but only slightly in- creased the freq"
},
{
"paper": "TH1 effector CD4 T cells rely on IFN-γ production to induce alopecia areata",
"n_hits": 4,
"quote": "tiva- tion including Cd44, Pdcd1, Icos, and Ctla4 (Fig. 3C). We also found several genes with increased expression relating to TH1 differentia- tion and function including Stat4, Tbx21, Stat1, Ifng, Il18r1, Il12rb1, and Cxcr3 (Fig. 3C). We next used the decoupleR package to infer TF activity. We com"
}
],
"CXCL12": [
{
"paper": "CXCL12 Neutralizing Antibody Promotes Hair Growth in Androgenic Alopecia and Alopecia Areata",
"n_hits": 200,
"quote": "Citation: Zheng, M.; Kim, M.-H.; Park, S.-G.; Kim, W.-S.; Oh, S.-H.; Sung, J.-H. CXCL12 Neutralizing Antibody Promotes Hair Growth in Androgenic Alopecia and Alopecia Areata. Int. J. Mol. Sci. 2024, 25, 1705. https://doi.org/10.3390/ ijms25031705 Academic Editor: Paw"
},
{
"paper": "Impact of SDF-1 and AMD3100 on Hair Follicle Dynamics in a Chronic Stress Model",
"n_hits": 155,
"quote": "Karri, S.S.; Andersen, B. The circadian clock and diseases of the skin. FEBS Lett. 2021, 595, 24132436. [CrossRef] 9. Cambier, S.; Gouwy, M.; Proost, P. The chemokines CXCL8 and CXCL12: Molecular and functional properties, role in disease and efforts towards pharmacological intervention. Cell. Mol."
},
{
"paper": "CXCL12 Drives Reversible Fibroimmune Remodeling in Androgenetic Alopecia Revealed by Single-Cell RNA Sequencing",
"n_hits": 112,
"quote": "Gabbiani Received: 17 June 2025 Revised: 4 July 2025 Accepted: 7 July 2025 Published: 8 July 2025 Citation: An, S.; Zheng, M.; Park, I.G.; Song, L.; Kim, J.; Noh, M.; Sung, J.-H. CXCL12 Drives Reversible Fibroimmune Remodeling in Androgenetic Alopecia Revealed by Single-Cell RNA Sequencing. Int. J. "
},
{
"paper": "ISEV2025 Abstract Book.",
"n_hits": 9,
"quote": "e addressed, they could be considered a promising tool for the direct delivery of therapeutic cargoes to tumours. Funding: University of Milan and McGill University PS2.899 CTHRC1+CXCL12+ fibroblasts-epithelia communication via exosome foster MDMs accumulation and aggravate lung injury Presenter: Ch"
}
],
"CXCR4": [
{
"paper": "Impact of SDF-1 and AMD3100 on Hair Follicle Dynamics in a Chronic Stress Model",
"n_hits": 115,
"quote": "ronic stress is a common cause of hair loss, involving inflammatory responses and changes in cellular signaling pathways. This study explores the mechanism of action of the SDF- 1/CXCR4 signaling axis in chronic stress-induced hair loss. The research indicates that SDF-1 pro- motes hair follicle gro"
},
{
"paper": "CXCL12 Drives Reversible Fibroimmune Remodeling in Androgenetic Alopecia Revealed by Single-Cell RNA Sequencing",
"n_hits": 32,
"quote": "on driving CXCL12 expression. Autocrine CXCL12-ACKR3 signaling in DFs activated TGF-β pathways and promoted fibrotic extracellular matrix deposition. In parallel, paracrine CXCL12-CXCR4 signaling reprogrammed Sox2+Twist1+ dermal papilla cells (DPCs) and promoted the accumulation of pro-fibrotic Trem"
},
{
"paper": "CXCL12 Neutralizing Antibody Promotes Hair Growth in Androgenic Alopecia and Alopecia Areata",
"n_hits": 28,
"quote": "ns increased the secretion of CXCL12 from DFs through the androgen receptor (AR). Secreted CXCL12 from DFs increased the expression of the AR and C-X-C Motif Chemokine Receptor 4 (CXCR4) in dermal papilla cells (DPCs), which induced hair loss in AGA. Likewise, CXCL12 expression is increased in AA mi"
},
{
"paper": "ISEV2025 Abstract Book.",
"n_hits": 14,
"quote": "variation in terms of surface markers and expression of miR-29 and miR-126, previously detected also in PLTs. LCEP-EVs induced endothelial activation (upregulation of CXCL1, CCL2, CXCR4 and VCAM1) and enhanced neutrophil adhesion and migration compared to HDEP-EVs, without affecting angiogene- sis. "
}
],
"FOXP3": [
{
"paper": "Blockade of IL-7 signaling suppresses inflammatory responses and reverses alopecia areata in C3H HeJ mice",
"n_hits": 55,
"quote": "s. pSTAT5 MFI (2 × 10 ) ** * IL-7/GAPDH(×104) C3H NC C3H AA 0 2 4 6 G I 2 0 2 4 6 8 10 pSTAT5 MFI (2 × 10 ) 0 2 4 6 8 10 2 Isotype AA skin NC skin NC SDLN AA SDLN Isotype Foxp3 Foxp3+ B NC AA NC AA IL-7Rα CD8 CD4 H K 47.6 26.4 7.17 18.8 49.7 26.9 4.16 19.3 38.8 42.4 3.28 15.5 39.8 41.0 2.91 16.3 5"
},
{
"paper": "Ox40-Cremediated deletion of BRD4 reveals an unexpected phenotype of hair follicle stem cells in alopecia",
"n_hits": 55,
"quote": "stimulatory molecule in the TNF receptor superfamily primarily involved in Treg prolif­ eration, survival, and memory generation (3, 4). In naive mice, OX40 is mainly expressed by Foxp3+ Tregs (5). However, upon immune activation, activated T effector cells also express OX40, and upon binding its li"
},
{
"paper": "Immunoregulatory Effects of Myeloid-Derived Suppressor Cell Exosomes in Mouse Model of Autoimmune Alopecia Areata",
"n_hits": 32,
"quote": "ented progression and sufficed for partial hair regrowth. Deep sequencing of lymphocyte mRNA from these mice revealed a significant increase in immunoregula­ tory mRNA, including FoxP3 and arginase 1. Downregulated mRNA was preferentially engaged in prohibiting T cell hyperreactivity. Taken together"
},
{
"paper": "Selective Expansion of Tregs Using the IL-2 Cytokine Antibody Complex Does Not Reverse Established Alopecia Areata in C3H HeJ Mice",
"n_hits": 24,
"quote": "se overnight before embedding in OCT. Tissue sections were stained primarily with anti-CD3-BV480 (1:1,000, 17A2), anti-CD4-AF488 (1:250, RM4-5), anti-CD8a-PE (1:250, 53-6.7), anti-FoxP3-APC (1:250, FJK-16s), and anti-GL3-biotin (1:250, GL3), followed by secondary SA-AF750 (1:10,000) at RT. Slides we"
}
],
"CTLA4": [
{
"paper": "Skin cancer understanding the journey of transformation from conventional to advanced treatment approaches.",
"n_hits": 9,
"quote": "cSSC cutaneous squamous cell carcinoma, PD1 Program Death 1, EGFR Epidermal growth factor receptor, NSCLC Non-small cell lung cancer, HNSCC Head and neck squamous cell carcinoma, CTLA-4 Cytotoxic t-lymphocyte associated protein-4 Treatment options Description Manifestation Approved Reference Convent"
},
{
"paper": "Gene Array Profiling and Immunomodulation Studies Define a Cell-Mediated Immune Response Underlying the Pathogenesis of Alopecia Areata in a Mouse Model and Humans",
"n_hits": 6,
"quote": "ia areata pathogenesis and suggested targeting antigen-pre- senting cells and reactive lymphocytes may be effect- ive in alopecia areata treatment. Key words: autoimmune/B7.1/B7.2/CTLA-4-mIgG2am/lymphocyte costimulation/rodent model. J Invest Dermatol 119:392± 402, 2002 A lopecia areata (AA) in huma"
},
{
"paper": "Selective Expansion of Tregs Using the IL-2 Cytokine Antibody Complex Does Not Reverse Established Alopecia Areata in C3H HeJ Mice",
"n_hits": 5,
"quote": "e with AA, NKG2D- expressing CD8 T cells widely infiltrate both haired and hairless skin areas, which have tissue-resident memory T-cell phenotypes. Tregs in the skin express CD25, CTLA-4, GATA-3, and Jagged1 and efficiently proliferate with IL-2 cytokine antibody complex. However, expanding Tregs in "
},
{
"paper": "SOCS3 treatment prevents the development of alopecia areata by inhibiting CD8+ T cell-mediated autoimmune destruction",
"n_hits": 4,
"quote": "10 through modulating STAT3 activation [23]. Yuet al demonstrated that SOCS3 deletion in T lymphocytes suppresses development of chronic ocular inflammation via upregulation of CTLA-4 and expansion of regulatory T cells. SOCS3 interacts with CTLA-4 and negatively regulates CTLA-4 levels in T cells, "
}
],
"SOCS3": [
{
"paper": "SOCS3 treatment prevents the development of alopecia areata by inhibiting CD8+ T cell-mediated autoimmune destruction",
"n_hits": 144,
"quote": "Oncotarget 33432 www.impactjournals.com/oncotarget SOCS3 treatment prevents the development of alopecia areata by inhibiting CD8+ T cell-mediated autoimmune destruction Zhen Gao1, Yu-Qing Jin2, Wei Wu1 1Department of Plastic and Recons"
},
{
"paper": "JAK-STAT1 as therapeutic target for EGFR deficiency-associated inflammation and scarring alopecia",
"n_hits": 8,
"quote": "g hub, including downstream effectors (e.g., interferon induced genes: Ifi47, Ifi214, and Ifitm3) and the downregulation of its negative regulator suppressor of cytokine signaling 3 (Socs3; Fig. 3B, first panel). SOCS3 protein reduction could also be visualized in the hair follicles from skin sections f"
}
],
"NLRP3": [
{
"paper": "Total glucosides of paeony inhibit NLRP3 caspase-1 GSDMD-mediated inflammation and pyroptosis in C3H HeJ mice with alopecia areata",
"n_hits": 55,
"quote": "s://creativecommons.org/licenses/by/4.0/). Biomolecules and Biomedicine, 2025, Vol. 25, No. 4, 954964 954 www.biomolbiomed.com RESEARCH ARTICLE Total glucosides of paeony inhibit NLRP3/caspase-1/GSDMD-mediated inflammation and pyroptosis in C3H/HeJ mice with alopecia areata Jingfang Zhang 1,2, Zhiq"
},
{
"paper": "Induction of alopecia areata in C3H HeJ mice using polyinosinic-polycytidylic acid (poly[IC]) and interferon-gamma",
"n_hits": 53,
"quote": "chemical staining of the AA lesions revealed increased infiltration of CD4+ and CD8+ cells infiltration around the hair follicles. IFNγ and poly(I:C) increased the expression of NLRP3, IL-1β, CXCL9, CXCL10, and CXCL11 in mouse skin. Taken together, these findings indicate a shorter and more convenie"
},
{
"paper": "ISEV2025 Abstract Book.",
"n_hits": 37,
"quote": "the extracellular space Invited Speaker: Janis A. Müller Philipps University Marburg, Germany OF14.1 Human milk-derived extracellular vesicles reduce NF-kB pathway activation and NLRP3 inflammasome formation in vitro and in vivo Jueqin Lu, Jasmyne A. Storm, Mon Fran Obtial, Sanoji Wijenayake Departm"
},
{
"paper": "Modulating immune responses in alopecia therapeutic insights and potential targets of antisense oligonucleotides",
"n_hits": 14,
"quote": "antibodies: rabbit anti-IL-6 (Cat# ab208113, RRID: AB_2927421, Abcam; 1:1000), mouse anti-TNF-α (Cat# sc-52746, RRID: AB_630341, Santa Cruz Bio­ technology; 1:1500), mouse anti-NLRP3 (Cat# AG- 20B-0014-C100, RRID: AB_2885199, AdipoGen; 1:1500), rabbit anti-AR (Cat# D6F11, RRID: AB_2799166, Cell Sign"
}
],
"RIPK1": [
{
"paper": "The Involvement of RIPK1 in Alopecia Areata",
"n_hits": 87,
"quote": "Revised: 6 February 2025 Accepted: 10 February 2025 Published: 13 February 2025 Citation: Kim, H.; Zheng, M.; An, S.; Park, I.G.; Song, L.; Noh, M.; Sung, J.-H. The Involvement of RIPK1 in Alopecia Areata. Int. J. Mol. Sci. 2025, 26, 1565. https://doi.org/10.3390/ ijms26041565 Copyright: © 2025 by t"
}
],
"AKT1": [
{
"paper": "Pilose antler extracts promotes hair growth in androgenetic alopecia mice by activating hair follicle stem cells via the AKT and Wnt pathways",
"n_hits": 70,
"quote": "Pilose antler extracts promotes hair growth in androgenetic alopecia mice by activating hair follicle stem cells via the AKT and Wnt pathways Fenglong Wang 1†, Gaiying He2†, Menghua Liu1, Yanan Sun 2, Shuhua Ma2, Zhenxiao Sun1* and Yi Wang2* 1School of Life Sciences, Beijing University of Chinese Me"
},
{
"paper": "Effects of Baicalin on Alopecia and the Associated Mechanism",
"n_hits": 49,
"quote": "ation of cell-cell adhesion, vesicle lumen, cytoplasmic vesicle, membrane raft, and endopeptidase activity. Multiple pathways were identified, such as proteoglycans in cancer, PI3K/AKT, and forkhead box O signaling pathways. Following baicalin treatment for the experimental mice, the coverage, length"
},
{
"paper": "Therapeutic potential of isoproterenol in androgenetic alopecia activation of hair follicle stem cells via the PI3K AKT β-Catenin signaling pathway",
"n_hits": 45,
"quote": "owth in animal models via the Sonic Hedgehog (SHH) pathway, but its potential for treating clinical AGA patients remains unexamined. Methods We investigated the role of the PI3K/AKT signaling pathway in AGA pathogenesis, focusing on the hair follicle-sympathetic nerve axis. The ADRB2 agonist, isopro"
},
{
"paper": "Caizhixuan hair tonic regulates both apoptosis and the PI3K Akt pathway to treat androgenetic alopecia",
"n_hits": 36,
"quote": "RESEARCH ARTICLE Caizhixuan hair tonic regulates both apoptosis and the PI3K/Akt pathway to treat androgenetic alopecia Tingting FangID1, Ruofei Xu2, Shaopeng Sun1, Yineng He1, Yi Yan1, Hongyang Fu3, Hongbin Luo3, Yi Cao3, Maocan TaoID3* 1 The First Clinical M"
}
],
"MTOR": [
{
"paper": "Corticotropin-releasing hormone inhibits autophagy by suppressing PTEN to promote apoptosis in dermal papilla cells",
"n_hits": 31,
"quote": "suppress autophagy, leading to DPC apoptosis. Overexpression of PTEN enhanced autophagy and mitigated CRH-dependent DPC apoptosis. CRH inhibited PTEN and activated the PI3K/AKT/mTOR pathway, whereas rapamycin inhibited this pathway and activated autophagy, consequently lowering apoptosis, suggesting"
},
{
"paper": "The human umbilical cord-mesenchymal stem cell secretome regulates hair growth and cycle transition by promoting methylthioadenosine synthesis via the PI3K AKT mTOR pathway",
"n_hits": 30,
"quote": "ermal papilla cells and hair matrix cells through cysteine and methionine metabolism; and stimulates methylthioadenosine synthesis in hair matrix cells by activating the PI3K/AKT/mTOR signaling pathway. Clinical studies demonstrated that SCT increased human hair density and average hair diameter. Sc"
},
{
"paper": "Arginine Metabolic Disruption Impairs Hair Regeneration via ROSMediated Inactivation of mTOR Signaling in Androgenetic Alopecia",
"n_hits": 28,
"quote": "RESEARCH ARTICLE www.advancedscience.com Arginine Metabolic Disruption Impairs Hair Regeneration via ROS-Mediated Inactivation of mTOR Signaling in Androgenetic Alopecia Shixin Duan, Guo Li, Yanji Chu, Junbo Zhang, Li Yang, Yujin Zhang, Fangfen Liu, Jiayun Li, Mengting Chen, Ben Wang, Zhixiang Zhao,"
},
{
"paper": "Multifunctional nanomedicine targeting the 'seed-and-soil' of hair follicles via simultaneous alleviation of oxidative stress and activation of autophagy for androgenetic alopecia therapy",
"n_hits": 16,
"quote": "mitigate oxidative stress and inhibiting intracellular oxidative damage via the suppression of c-Jun phosphorylation. Addi­ tionally, Cur inhibits the phosphorylation of Akt and mTOR, which in turn promotes the expression of LC3B and activates the autophagy pathway. Thus, Curs ability to both reduc"
}
],
"PTEN": [
{
"paper": "Corticotropin-releasing hormone inhibits autophagy by suppressing PTEN to promote apoptosis in dermal papilla cells",
"n_hits": 84,
"quote": "Research Article Annals of Medicine 2025, VOL. 57, NO. 1, 2490823 Corticotropin-releasing hormone inhibits autophagy by suppressing PTEN to promote apoptosis in dermal papilla cells Wenzi Lianga, Xiuwen Chenb, Na Nic, Chutong Zhuangc, Zhiying Yua, Ziqing Xua, Yingshi Lia, Changmin Lina and Keng Huan"
},
{
"paper": "ISEV2025 Abstract Book.",
"n_hits": 18,
"quote": "viron- ment. OF11.3 Delivery of melanoma cell-derived miR-92b-3p by extracellular vesicles promotes the formation of carcinoma-associated fibroblasts through the downregulation of PTEN Stefanie Kewitz-Hempel1, Nicola Windisch1, Gerd Hause2, Lutz Müller3, Cord Sunderkötter1, Dennis Gerloff1 1Departme"
},
{
"paper": "Skin cancer understanding the journey of transformation from conventional to advanced treatment approaches.",
"n_hits": 11,
"quote": "pathway predominantly facilitates proliferation and invasion. One of the inhibi- tors of the PI3K pathway is the enzyme phosphatase and tensing homolog deleted on chromosome 10 (PTEN). PTEN catalyzes the de-phosphorylation reaction of phosphatidylinositol 3,4,5-trisphosphate (PIP3) back to phosphati"
}
],
"SIRT1": [
{
"paper": "Jiawei Erzhiwan Ameliorates Androgenetic Alopecia by Regulating the SIRT1 JNK p38 MAPK Pathway",
"n_hits": 46,
"quote": "O R I G I N A L R E S E A R C H Jiawei Erzhiwan Ameliorates Androgenetic Alopecia by Regulating the SIRT1/JNK/p38 MAPK Pathway Zhiguang Huang1,2,*, Yuanyuan Li3,*, Yixin Xie1,2,*, Hangjie Fu2,4, Zhiwei Weng1,2, Jianchang Yuan1,2, Lan Wu1,2, Weizhou Lin1,2, Yi Cao3, Bin Ding 1,2,5 1S"
},
{
"paper": "Modulating immune responses in alopecia therapeutic insights and potential targets of antisense oligonucleotides",
"n_hits": 43,
"quote": "mon under­ lying molecular pathways, particularly involving the dysregulation of microRNAs (miRNAs) and key cellular signaling molecules [812]. One such molecule of interest is SIRT1, a mem­ ber of the sirtuin family of NAD+dependent protein BMC Immunology *Correspondence: Hyun-Jeong Cho hjcho@kony"
},
{
"paper": "Extracellular vesicles in age-related diseases disease pathogenesis, intervention, and biomarker.",
"n_hits": 11,
"quote": "n endothelial cells (HUVECs), EVs released by the cells deliver elevated amount of miR-21-5p and miR-217, which impair the expression of DNA methyl- transferase 1 and Sirtuin-1 (SIRT1), thus affecting DNA methylation and cells replication ability [19]. Other stud- ies have also discovered that EVs f"
}
],
"IGF1": [
{
"paper": "Self-assembling peptide inspired by insulin and type 1 insulin-like growth factor for the treatment of androgenetic alopecia",
"n_hits": 94,
"quote": "PR China f Tianjin Eye Hospital, No. 4 Gansu Road, Heping District, Tianjin, 300020, PR China A R T I C L E I N F O Keywords: Peptide Self-assembly Insulin-like growth factor 1 (IGF-1) Hair regrowth Androgenetic alopecia (AGA) A B S T R A C T Androgenetic alopecia (AGA), the most prevalent form of h"
},
{
"paper": "The AR miR-221 IGF-1 pathway mediates the pathogenesis of androgenetic alopecia",
"n_hits": 83,
"quote": ". Sci. 2023, Vol. 19 https://www.ijbs.com 3307 International Journal of Biological Sciences 2023; 19(11): 3307-3323. doi: 10.7150/ijbs.80481 Research Paper The AR/miR-221/IGF-1 pathway mediates the pathogenesis of androgenetic alopecia Kaitao Li†, Yang Sun†, Shizhao Liu†, Yi Zhou, Qian Qu, Gaofeng W"
},
{
"paper": "Drug Delivery System Based On Minoxidil Nanoparticles Promotes Haira Growth in C57BL6 Mice",
"n_hits": 35,
"quote": ". C57BL/6 mice were used to evaluate hair-growth effects. The expression levels of mRNA and protein for vascular endothelial growth factor (VEGF) and insulin-like growth factor-1 (IGF-1) were determined by real-time PCR and ELISA methods, respectively. Results: The ratio of solid-MXD was approximate"
},
{
"paper": "Hair Growth Effect of DN106212 in C57BL 6 Mouse and Its Network Pharmacological Mechanism of Action",
"n_hits": 22,
"quote": "2017, 309, 729738. [CrossRef] 52. Hu, Z.-Q.; Hou, C.; Miao, Y.; Wang, J.; Wang, X.; Chen, C.-Y. Collagenase IV plays an important role in regulating hair cycle by inducing VEGF, IGF-1, and TGF-β expression. Drug Des. Dev. Ther. 2015, 9, 53735383. [CrossRef] 53. Semon, H.C. An Atlas of the Commoner"
}
],
"VEGFA": [
{
"paper": "Hydrogel forming microneedles loaded with VEGF and Ritlecitinib,polyhydroxyalkanoates nanoparticles for mini-invasive androgenetic alopecia treatment",
"n_hits": 45,
"quote": "alf of KeAi Communications Co. Ltd. This is an open access article under the CC BY license (http://creativecommons.org/licenses/by/4.0/). Hydrogel forming microneedles loaded with VEGF and Ritlecitinib/ polyhydroxyalkanoates nanoparticles for mini-invasive androgenetic alopecia treatment Yan-Wen Din"
},
{
"paper": "Drug Delivery System Based On Minoxidil Nanoparticles Promotes Haira Growth in C57BL6 Mice",
"n_hits": 35,
"quote": "pm, 30 s×15 times, intermittent milling). C57BL/6 mice were used to evaluate hair-growth effects. The expression levels of mRNA and protein for vascular endothelial growth factor (VEGF) and insulin-like growth factor-1 (IGF-1) were determined by real-time PCR and ELISA methods, respectively. Results"
},
{
"paper": "ISEV2025 Abstract Book.",
"n_hits": 29,
"quote": "which was further augmented with OCY-derived EVs. In particular, OCY-derived maEVs led to a significant increase in tube formation with thicker vessels present, comparable to the +VEGF control, and also increased HUVEC migration and proliferation. Remarkably, treatment with OCY-derived maEVs leads t"
},
{
"paper": "Minoxidil delivered via a stem cell membrane delivery controlled release system promotes hair growth in C57BL6J mice",
"n_hits": 26,
"quote": "and differential centrifugation, and their effects on hair growth were evaluated using C57BL/6J mice. The mRNA and protein expression levels of vascular endothelial growth factor (VEGF) and insulin-like growth factor-1 (IGF-1) were detected by real-time polymerase chain reaction and enzyme-linked im"
}
],
"FGF7": [
{
"paper": "BFNB Enhances Hair Growth in C57BL 6 Mice through the",
"n_hits": 32,
"quote": "Citation: Pérez-Mora, S.; Ocampo-López, J.; Gómez-García, M.d.C.; Pérez-Ishiwara, D.G. BFNB Enhances Hair Growth in C57BL/6 Mice through the Induction of EGF and FGF7 Factors and the PI3K-AKT-β-Catenin Pathway. Int. J. Mol. Sci. 2023, 24, 12110. https:// doi.org/10.3390/ijms241512110 Academic Editor"
},
{
"paper": "Subcutaneous injection of genetically engineered exosomes for androgenic alopecia treatment",
"n_hits": 16,
"quote": "e-based targeted delivery platform, designated as EX104, through the engineering of HEK-293 cells to express a combination of therapeutical molecules, including WNT10B, VEGFA, and FGF7. EX104 reversed the hair follicle miniaturization phenotype in DHT-induced DPCs. Furthermore, it demonstrated signi"
},
{
"paper": "Restoration of follicular β-catenin signaling by mesenchymal stem cells promotes hair growth in mice with androgenetic alopecia",
"n_hits": 14,
"quote": "CG GTCTGATCTCTTTCCCCAACTCT Cdk4 (mouse) CTGAACCGCTTTGGCAAGAC GCCCTCTCTTATCGCCAGAT β-catenin (mouse) GTTCGCCTTCATTATGGACTGCC ATAGCACCCTGTTCCCGCAAAG Fgf7 (mouse) TGGGCACTATATCTCTAGCTTGC GGGTGCGACAGAACAGTCT Gapdh (mouse) CATCACTGCCACCCAGAAGACTG ATGC"
},
{
"paper": "Deletion of hypoxia-inducible factor prolyl 4-hydroxylase 2 in FoxD1-lineage mesenchymal cells leads to congenital truncal alopecia",
"n_hits": 11,
"quote": "8 P21 P24 0.0 1.0 2.0 3.0 4.0 5.0 6.0 A Control cKO Keratin 1 Keratin 5 Loricrin C Relative Krt5 mRNA * Relative Krt1 mRNA ** * Relative Krt10 mRNA ** * Relative Lor mRNA Relative Kgf mRNA Relative Krt15 mRNA Control cKO Skin overview Hair follicle Skin surface Hair shaft B Relative Krt14 mRNA *** *"
}
],
"FGF5": [
{
"paper": "Cyclic alopecia in Msx2 mutants defects in hair cycling and hair shaft differentiation",
"n_hits": 18,
"quote": "entiation, together with concealed skin domains, account for the cyclic alopecia phenotype. Keywords Alopecia; Hair cycle; Hair differentiation; Homeobox genes; Msx2; Foxn1; Ha3; Fgf5; Mouse © 2003 The Company of Biologists Ltd *Authors for correspondence (chuong@pathfinder.usc.edu and maas@rascal.m"
},
{
"paper": "Overexpression of Bcl-2 Protects from Ultraviolet B-Induced Apoptosis but Promotes Hair Follicle Regression and Chemotherapy-Induced Alopecia",
"n_hits": 8,
"quote": "A, Fuchs EV, Thompson CB: Manipulation of outer root sheath cell survival perturbs the hair-growth cycle. EMBO J 1999, 18:35963603 41. Hebert JM, Rosenquist T, Gotz J, Martin GR: FGF5 as a regulator of the hair growth cycle: evidence from targeted and spontaneous mutations. Cell 1994, 78:10171025 "
},
{
"paper": "Prostaglandin D2 Inhibits Hair Growth and Is Elevated in Bald Scalp of Men with Androgenetic Alopecia",
"n_hits": 5,
"quote": "ured the expression of the receptor for PGF2α, which is known for its ability to induce hair growth both in mice (20) and in humans (15). In contrast to the late peak of Ptgds and Fgf5, prostaglandin F receptor (Ptgfr) mRNA peaked in early anagen or late telogen, with a 21-fold change versus second "
},
{
"paper": "The Genetic Landscape of Androgenetic Alopecia Current Knowledge and Future Perspectives.",
"n_hits": 4,
"quote": "including WNT signaling, androgen metabolism, apoptosis, and morphogenesis [11]. This built on an earlier meta-analysis that had expanded candidate loci to implicate genes such as FGF5, IRF4, DKK2, and pathways including melatonin signaling and adipogenesis [12]. Because many participants in these s"
}
],
"HGF": [
{
"paper": "Exploring the Efficacy and Potential Mechanisms of Topical Periplaneta americana (L.) Extract in Treating Androgenetic Alopecia in a Mouse Model A Systems Pharmacology and Skin Microbiome Analysis",
"n_hits": 14,
"quote": "as purchased from Aladdin Reagent Co., Ltd. (Shanghai, China). Isoflurane was purchased from Reward Technology Co., Ltd. (Jinan, China). Vascular endothelial growth factor (VEGF), Hepatocyte Growth Factor (HGF), alkaline phosphatase (ALP/AKP), estradiol (E2), malondialdehyde (MDA), tumor necrosis fa"
},
{
"paper": "Cell-free fat extract restores hair loss a novel therapeutic strategy for androgenetic alopecia",
"n_hits": 6,
"quote": "\u0007Conditioned media DHT \u0007Dihydrotestosterone DPCs \u0007Dermal papilla cells ELISA \u0007Enzyme-linked immunosorbent assay hDPCs \u0007Human dermal papilla cells HE \u0007Hematoxylineosin HGF \u0007Hepatocyte growth factor IGF \u0007Insulin-like growth factor MLA assay \u0007Mouse lymohoma TK assay PDGF \u0007Platelet-derived growth facto"
},
{
"paper": "Cell-free fat extract restores hair loss a novel therapeutic strategy for androgenetic alopecia",
"n_hits": 6,
"quote": "\u0007Conditioned media DHT \u0007Dihydrotestosterone DPCs \u0007Dermal papilla cells ELISA \u0007Enzyme-linked immunosorbent assay hDPCs \u0007Human dermal papilla cells HE \u0007Hematoxylineosin HGF \u0007Hepatocyte growth factor IGF \u0007Insulin-like growth factor MLA assay \u0007Mouse lymohoma TK assay PDGF \u0007Platelet-derived growth facto"
},
{
"paper": "Overcoming the Low Bioavailability of Apigenin The Therapeutic Efficacy for Androgenetic Alopecia Through Topical Administration",
"n_hits": 6,
"quote": "β (GSK-­3β) is a key regulator of the Wnt signaling pathway, which is crucial for hair follicle development and hair cycling. Inhibiting GSK-­3β leads to promoting hair growth. Hepatocyte growth factor (HGF) is secreted by cells in the hair follicle, particularly the DPC, and it stimulates neighbori"
}
],
"GAS6": [
{
"paper": "Triton modified polyethyleneimine conjugates assembled with growth arrest-specific protein 6 for androgenetic alopecia transdermal gene therapy",
"n_hits": 54,
"quote": "ceutical Biotechnology, Nanjing University, Nanjing, 210023, Jiangsu, People's Republic of China A R T I C L E I N F O Keywords: Gene therapy Non-viral vector Transdermal delivery Gas6 Hair reproduction Androgenetic alopecia A B S T R A C T Androgenetic alopecia is an androgen-dependent skin disorde"
}
],
"PDGFA": [
{
"paper": "A combination therapy for androgenic alopecia based on quercetin and zinc copper dual-doped mesoporous silica nanocomposite microneedle patch",
"n_hits": 17,
"quote": "ge >1 and false discovery rate (FDR) < 0.05 were considered as a significant difference. 2.14. The gene expression in normal or injured HHDPCs treated by ZCQ Gene expression of PDGF, TGF-β, C-Myc, MMP2 and CCN1 in normal or injured HHDPCs were detected by quantitative PCR (qPCR). Briefly, HHDPCs (1 "
},
{
"paper": "Self-assembling peptide inspired by insulin and type 1 insulin-like growth factor for the treatment of androgenetic alopecia",
"n_hits": 7,
"quote": "ascular endothelial growth factor (VEGF), which enhanced the repair of ischemic tissues [21]. Yang et al. designed a self-assembling peptide with platelet-derived growth factor (PDGF) bioactivity, successfully promoting the healing of radiation-induced injury [22]. Subsequently, Shi et al. also empl"
},
{
"paper": "Cell-free fat extract restores hair loss a novel therapeutic strategy for androgenetic alopecia",
"n_hits": 5,
"quote": "ing with CEFFE regardless of the presence or absence of DHT. In other studies, HGF was associated with the span of the hair follicle stages, and platelet-derived growth factor (PDGF) promotes and maintains the anagen stage. Thus, we speculate that HGF and PDGF may play a crucial role in hair cycle c"
},
{
"paper": "Cell-free fat extract restores hair loss a novel therapeutic strategy for androgenetic alopecia",
"n_hits": 5,
"quote": "ing with CEFFE regardless of the presence or absence of DHT. In other studies, HGF was associated with the span of the hair follicle stages, and platelet-derived growth factor (PDGF) promotes and maintains the anagen stage. Thus, we speculate that HGF and PDGF may play a crucial role in hair cycle c"
}
],
"TGFB1": [
{
"paper": "ISEV2025 Abstract Book.",
"n_hits": 59,
"quote": "B-I00 project from the Ministry of Science and Innovation of the Government (Spain); Consorzio Interuniversitario Nazionale per la Scienza e Tecnologia dei Materiali—INSTM. OF10.4 TGF-β-activated cancer-associated fibroblasts remodel the tumour microenvironment through extracellular vesicle surface-"
},
{
"paper": "Deletion of hypoxia-inducible factor prolyl 4-hydroxylase 2 in FoxD1-lineage mesenchymal cells leads to congenital truncal alopecia",
"n_hits": 35,
"quote": "the depletion of Hif-p4h-2 led to HIF stabiliza- tion and dysregulation of multiple genes involved in keratin formation, HF differentiation, and HIF, transforming growth factor β (TGF-β), and Notch signaling. We hypothesize that the failure of HF cycling is likely to be mechanistically caused by dis"
},
{
"paper": "iTRAQ-based quantitative proteomics revealing the therapeutic mechanism of a medicinal and edible formula YH0618 in reducing doxorubicin-induced alopecia by targeting and TGF-b Smad3 pathway",
"n_hits": 16,
"quote": "RAQ-based quantitative proteomics revealing the therapeutic mechanism of a medicinal and edible formula YH0618 in reducing doxorubicin-induced alopecia by targeting keratins and TGF-β/ Smad3 pathway Renkai Li a,b,1, Mingxia Chen a,1, Danxi Yan a, Liang Chen c, Mandi Lin d, Bohui Deng a, Likai Zhuang"
},
{
"paper": "iTRAQ-based quantitative proteomics revealing the therapeutic mechanism of a medicinal and edible formula YH0618 in reducing doxorubicin-induced alopecia by targeting keratins and TGF-β Smad3 pathway",
"n_hits": 16,
"quote": "RAQ-based quantitative proteomics revealing the therapeutic mechanism of a medicinal and edible formula YH0618 in reducing doxorubicin-induced alopecia by targeting keratins and TGF-β/ Smad3 pathway Renkai Li a,b,1, Mingxia Chen a,1, Danxi Yan a, Liang Chen c, Mandi Lin d, Bohui Deng a, Likai Zhuang"
}
],
"SMAD3": [
{
"paper": "Kartogenin regulates hair growth and hair cycling",
"n_hits": 45,
"quote": "ch the transforming growth factor (TGF)-β2 is crucial [19-21]. TGF-β2, which is a multifunctional cytokine, propagates signals via TGF-β receptor and phosphorylating Smad2 and Smad3 [22]. Various studies demonstrated that TGF-β2 is a catagen phase inducer and inhibition of TGF-β2 activity during hai"
},
{
"paper": "iTRAQ-based quantitative proteomics revealing the therapeutic mechanism of a medicinal and edible formula YH0618 in reducing doxorubicin-induced alopecia by targeting and TGF-b Smad3 pathway",
"n_hits": 35,
"quote": "d quantitative proteomics revealing the therapeutic mechanism of a medicinal and edible formula YH0618 in reducing doxorubicin-induced alopecia by targeting keratins and TGF-β/ Smad3 pathway Renkai Li a,b,1, Mingxia Chen a,1, Danxi Yan a, Liang Chen c, Mandi Lin d, Bohui Deng a, Likai Zhuang a, Fei "
},
{
"paper": "iTRAQ-based quantitative proteomics revealing the therapeutic mechanism of a medicinal and edible formula YH0618 in reducing doxorubicin-induced alopecia by targeting keratins and TGF-β Smad3 pathway",
"n_hits": 35,
"quote": "d quantitative proteomics revealing the therapeutic mechanism of a medicinal and edible formula YH0618 in reducing doxorubicin-induced alopecia by targeting keratins and TGF-β/ Smad3 pathway Renkai Li a,b,1, Mingxia Chen a,1, Danxi Yan a, Liang Chen c, Mandi Lin d, Bohui Deng a, Likai Zhuang a, Fei "
},
{
"paper": "Deletion of hypoxia-inducible factor prolyl 4-hydroxylase 2 in FoxD1-lineage mesenchymal cells leads to congenital truncal alopecia",
"n_hits": 6,
"quote": "rophages is associated with TGFβ1-induced plasminogen activator inhibitor 1 production and is reversibly inhibited by HIF1α silencing (66). Hypoxia also affects directly the SMAD2SMAD3 complex by enhancing its transfer to the nucleus in human dermal fibroblasts and subsequently drives them into tran"
}
],
"PTGDS": [
{
"paper": "Prostaglandin D2 Inhibits Hair Growth and Is Elevated in Bald Scalp of Men with Androgenetic Alopecia",
"n_hits": 199,
"quote": "ndin D2 synthase (PTGDS) is elevated at the mRNA and protein levels in bald scalp compared to haired scalp of men with AGA. The product of PTGDS enzyme activity, prostaglandin D2 (PGD2), is similarly elevated in bald scalp. During normal follicle cycling in mice, Ptgds and PGD2 levels increase immed"
},
{
"paper": "Use of genetics in the prediction of success in male pattern hair loss therapy and mechanistic studies.",
"n_hits": 14,
"quote": "dermal papilla integrity (Heilmann-Heimbach et al., 2017; Michel et al., 2017; Li et al., 2024). Functional studies of bald versus non-bald scalp confirm that prostaglandin D2 (PGD2) and its receptor GPR44 are upregulated in balding areas and that PGD2 directly inhibits hair growth, while prostaglan"
},
{
"paper": "Expanding the therapeutic landscape of minoxidil for androgenetic alopecia topical, oral and sublingual formulations.",
"n_hits": 2,
"quote": ". Prostaglandins are lipid mediators known to influence HF cycling. Specifically, prostaglandin E2 (PGE2) and prostaglandin F2α (PGF2α) promote hair growth whereas prostaglandin D2 (PGD2) is associated with hair growth inhibition and miniaturisation (Johnstone and Albert, 2002). Prostaglandins are pro"
}
],
"PTGDR2": [
{
"paper": "Use of genetics in the prediction of success in male pattern hair loss therapy and mechanistic studies.",
"n_hits": 17,
"quote": "y (Heilmann-Heimbach et al., 2017; Michel et al., 2017; Li et al., 2024). Functional studies of bald versus non-bald scalp confirm that prostaglandin D2 (PGD2) and its receptor GPR44 are upregulated in balding areas and that PGD2 directly inhibits hair growth, while prostaglandin F2α analogues, acti"
},
{
"paper": "Prostaglandin D2 Inhibits Hair Growth and Is Elevated in Bald Scalp of Men with Androgenetic Alopecia",
"n_hits": 16,
"quote": "H, Hirai H, Nagata K, Hara T, Utsuyama M, Hirokawa K, Sugamura K, Nishioka K, Nakamura M. Prostaglandin D2 plays an essential role in chronic allergic inflammation of the skin via CRTH2 receptor. J Immunol. 2006; 177:26212629. [PubMed: 16888024] 27. Eguchi N, Minami T, Shirafuji N, Kanaoka Y, Tanak"
},
{
"paper": "The Genetic Landscape of Androgenetic Alopecia Current Knowledge and Future Perspectives.",
"n_hits": 2,
"quote": "sex population Increased risk ACE [33] rs4343 Mixed ethnicity and mixed sex population Increased risk PTGFR [33] rs10782665 Mixed ethnicity and mixed sex population Increased risk PTGDR2 [33] rs533116 Mixed male and female population Increased risk rs545659 Mixed ethnicity and mixed sex population I"
}
],
"PTGFR": [
{
"paper": "Use of genetics in the prediction of success in male pattern hair loss therapy and mechanistic studies.",
"n_hits": 20,
"quote": "din balance and follicular miniaturisation. In contrast, prostaglandin F2α signalling through PTGFR is associated with pro-anagen effects, and pharmacological analogues such as latanoprost have demonstrated modest follicular enlargement in small human studies (Blume-Peytavi et al., 2012; Suchonwanit"
},
{
"paper": "Prostaglandin D2 Inhibits Hair Growth and Is Elevated in Bald Scalp of Men with Androgenetic Alopecia",
"n_hits": 12,
"quote": "hibit hair growth, likely through the GPR44 receptor. DISCUSSION Recent evidence has illustrated a role for prostaglandins in regulating hair growth. For example, the PGF2α analog latanoprost is Food and Drug Administration (FDA)approved and routinely used clinically to enhance hair growth of human"
},
{
"paper": "Statement from the frontal fibrosing alopecia international expert alliance SOFFIA 2024.",
"n_hits": 4,
"quote": "the involved scalp margin. • Topical minoxidil can be applied to eyebrows and has an optimal strength of 5% not 2%. Topical prostaglandins • Topical bimatoprost 0.03% or topical latanoprost 0.005% can be applied to the eyebrows. • Topical bimatoprost 0.03% or topical latanoprost 0.005% is not an eff"
},
{
"paper": "Schizochytrium sp. Extracted Lipids Prevent Alopecia by Enhancing Antioxidation and Inhibiting Ferroptosis of Dermal Papilla Cells",
"n_hits": 3,
"quote": "lenic acid (18:3; ω-3; α-LA), eicosapentaenoic acid (20:5; ω-3; EPA), and docosahexaenoic acid (22:6; ω-3; DHA) [27]. Compounds that are structurally similar to ω-3 PUFAs, such as latanoprost, isopropyl unoprostone, and bimatoprost, induce hair growth in both mice and humans [28,29]. Moreover, a mac"
}
],
"TP53": [
{
"paper": "Polyphenols from Bacopa procumbens Nanostructured with Gold Nanoparticles Stimulate Hair Growth Through Apoptosis Modulation in C57BL 6 Mice",
"n_hits": 87,
"quote": "biological activities of the secondary metabolites of B. procumbens present in BFNB were analyzed in silico. In vivo experiments evaluated the expression of pro-apoptotic markers p53, caspase 3-p11, caspase 9-p10, and Bax, as well as anti-apoptotic marker Bcl-2, through Western blotting. Immunohisto"
},
{
"paper": "Role for the Epidermal Growth Factor Receptor in Chemotherapy-Induced Alopecia",
"n_hits": 40,
"quote": "decreased follicular proliferation, but did not progress to telogen as did Egfr wild type follicles. Egfr mutant follicles responded with less proliferation, apoptosis, and fewer p53-positive cells after cyclophosphamide. Treatment of control mice with the EGFR inhibitors erlotinib or gefitinib simi"
},
{
"paper": "Effect of N-acetylcysteine on hair follicle changes in mouse model of cyclophosphamide-induced alopecia histological and biochemical study",
"n_hits": 31,
"quote": "uced an increase in malondialdehyde (MDA), decrease in superoxide dismutase (SOD), histological hair follicle dystrophy, disruption of follicular melanogenesis, overexpression of p53, and loss of ki67 immunoreactivity. NAC coadmin- istration in group III reversed CYP-induced alterations in the bioch"
},
{
"paper": "ISEV2025 Abstract Book.",
"n_hits": 30,
"quote": "edicine, we also identified a further need for testing to ultimately decide if ASC-EVs really are the Jack of all trades or masters of none. PS1.9 Exploring the biodistribution of p53-containing EVs for targeted cancer therapy Ishai Luz1, Gil Shalev2, Doaa Massad1, Tomer Cooks1, Alexander Tendler2 1"
}
],
"CDK4": [
{
"paper": "CDK4 6 inhibition mitigates stem cell damage in a novel model for taxaneinduced alopecia",
"n_hits": 60,
"quote": "Article CDK4/6 inhibition mitigates stem cell damage in a novel model for taxane-induced alopecia Talveen S Purba1,* , Kayumba Ngandu1, Lars Brunken2, Eleanor Smart1 , Ellen Mitchell1, Nashat"
},
{
"paper": "ISEV2025 Abstract Book.",
"n_hits": 10,
"quote": "ase with elevated EVs in the serum of patients. One crucial regulator and prognostic biomarker for AML is the cell cycle regulator cyclin-dependent kinase 6 (CDK6). Palbociclib, a CDK4/6 kinase inhibitor, is already FDA-approved for breast cancer and in clinical trials for AML; however, the exact me"
},
{
"paper": "2,5-Diazabicyclo[2.2.1]heptane in medicinal chemistry a treasure trove of therapeutic opportunities.",
"n_hits": 8,
"quote": ", DCM, 25 °C, 3 h. RSC Medicinal Chemistry Review RSC Med. Chem. This journal is © The Royal Society of Chemistry 2026 Xu et al. discovered a series of pyrimidine-indazole- based CDK4 inhibitors by taking reference from the FDA- approved CDK4/6 inhibitors abemaciclib. The aim was to design inhibitor"
},
{
"paper": "Restoration of follicular β-catenin signaling by mesenchymal stem cells promotes hair growth in mice with androgenetic alopecia",
"n_hits": 3,
"quote": "AGAACAAGC CCTTGTTTAGCCAGAGGCCG Ccna1 (mouse) ACCGTGCTAGGGGTGTTGA CGTTTGGCTGGTTCATTGACC Cdk2 (mouse) GCGACCTCCTCCCAATATCG GTCTGATCTCTTTCCCCAACTCT Cdk4 (mouse) CTGAACCGCTTTGGCAAGAC GCCCTCTCTTATCGCCAGAT β-catenin (mouse) GTTCGCCTTCATTATGGACTGCC ATA"
}
],
"CDK6": [
{
"paper": "ISEV2025 Abstract Book.",
"n_hits": 10,
"quote": "in CRT-EVs compared to other sources, indicating its potential as a specific biomarker of OA. Funding: This research was supported by the APVV-17-0118 and VEGA 1/0146/24. PS2.756 CDK6 regulates extracellular vesicles in AML Belinda S. Maw1*, Elisabeth Gamper1*, Nathalie Havranek1, Astrid Digruber2, "
},
{
"paper": "2,5-Diazabicyclo[2.2.1]heptane in medicinal chemistry a treasure trove of therapeutic opportunities.",
"n_hits": 4,
"quote": "e-indazole- based CDK4 inhibitors by taking reference from the FDA- approved CDK4/6 inhibitors abemaciclib. The aim was to design inhibitors with greater selectivity for CDK4 over CDK6, achieving higher specificity in both enzymatic and cellular target engagement assays.103 Cyclin-dependent kinases "
},
{
"paper": "Extracellular vesicles in age-related diseases disease pathogenesis, intervention, and biomarker.",
"n_hits": 3,
"quote": "K-EVs and successfully suppressed pancreatic cancer cell pro- liferation [237, 238]. Bioinformatics analysis using miR- Walk identified several let-7b-5p target genes, including CDK6, CCNA2, and AURKB etc., all of which are impli- cated in cancer progression. Among these, CDK6 was significantly down"
}
],
"BCL2": [
{
"paper": "Overexpression of Bcl-2 Protects from Ultraviolet B-Induced Apoptosis but Promotes Hair Follicle Regression and Chemotherapy-Induced Alopecia",
"n_hits": 276,
"quote": "Overexpression of Bcl-2 Protects from Ultraviolet B- Induced Apoptosis but Promotes Hair Follicle Regression and Chemotherapy-Induced Alopecia Sven Mu¨ller-Ro¨ver,*† Heidemarie Rossiter,* Ralf Paus,‡ Bor"
},
{
"paper": "Polyphenols from Bacopa procumbens Nanostructured with Gold Nanoparticles Stimulate Hair Growth Through Apoptosis Modulation in C57BL 6 Mice",
"n_hits": 72,
"quote": "in BFNB were analyzed in silico. In vivo experiments evaluated the expression of pro-apoptotic markers p53, caspase 3-p11, caspase 9-p10, and Bax, as well as anti-apoptotic marker Bcl-2, through Western blotting. Immunohistochemistry further assessed the expression and localization of some of these "
},
{
"paper": "Connarus semidecandrus Jack Exerts Anti-Alopecia Effects by Targeting 5α-Reductase Activity and an Intrinsic Apoptotic Pathway",
"n_hits": 50,
"quote": "to the anagen phase. Western blotting indicated that Cs-EE reduced the expression of the androgenic receptor. Cs-EE treatment also inhibited programmed cell death by upregulating Bcl-2 expression at the mRNA and protein levels. The anti-alopecia effect of Cs-EE was confirmed by in vitro experiments s"
},
{
"paper": "Caizhixuan hair tonic regulates both apoptosis and the PI3K Akt pathway to treat androgenetic alopecia",
"n_hits": 26,
"quote": "- work pharmacology, CZX alleviated AGA by regulating PI3K/Akt and apoptosis pathways. According to RT-qPCR and Western blotting, CZX upregulated the expressions of PI3K, Akt, and Bcl-2, while downregulating that of Bax and caspase-3. PLOS ONE PLOS ONE | https://doi.org/10.1371/journal.pone.0282427 "
}
],
"EGFR": [
{
"paper": "JAK-STAT1 as therapeutic target for EGFR deficiency-associated inflammation and scarring alopecia",
"n_hits": 512,
"quote": "Article JAK-STAT1 as therapeutic target for EGFR deficiency-associated inflammation and scarring alopecia Karoline Strobl1, Jörg Klufa1, Regina Jin 1, Lena Artner-Gent 1, Dana Krauß 1, Philipp Novoszel1, Johanna Strobl2, Georg Sta"
},
{
"paper": "Role for the Epidermal Growth Factor Receptor in Chemotherapy-Induced Alopecia",
"n_hits": 155,
"quote": "of cancer patients with chemotherapeutics like cyclophosphamide often causes alopecia as a result of premature and aberrant catagen. Because the epidermal growth factor receptor (EGFR) signals anagen hair follicles to enter catagen, we hypothesized that EGFR signaling may be involved in cyclophospha"
},
{
"paper": "ISEV2025 Abstract Book.",
"n_hits": 52,
"quote": "nitoring Phenotypic Analyzer Chip (GEMPAC), which pro- files a novel central nervous system (CNS) and glioma stem cell (GSC) biomarker panel (ATP1B2, EAAT2, CD24, CD44, CD133, and EGFR) on circulating sEVs. Methods: GEMPAC identifies a unique GBM signature in sEVs by targeting CNS-specific markers A"
},
{
"paper": "Skin cancer understanding the journey of transformation from conventional to advanced treatment approaches.",
"n_hits": 24,
"quote": "apeutic implications. Thereafter, oncogenes like RAS and other suppressor genes like CDKN2A and NOTCH undergo additional genetic alterations. Epi- dermal growth factor receptor (EGFR) upregulation is eventually caused by the activation of several signaling pathways, including the Nuclear factor kapp"
}
],
"KRT17": [
{
"paper": "Keratin 17 null mice exhibit age- and strain-dependent alopecia",
"n_hits": 219,
"quote": "Keratin 17 null mice exhibit age- and strain-dependent alopecia Kevin M. McGowan,1,4 Xuemei Tong,1,4 Emma Colucci-Guyon,3 Francina Langa,3 Charles Babinet,3 and Pierre A. Coulombe1,2,5 1Depa"
},
{
"paper": "Keratin 17 null mice exhibit ageand strain-dependent alopecia",
"n_hits": 219,
"quote": "Keratin 17 null mice exhibit age- and strain-dependent alopecia Kevin M. McGowan,1,4 Xuemei Tong,1,4 Emma Colucci-Guyon,3 Francina Langa,3 Charles Babinet,3 and Pierre A. Coulombe1,2,5 1Depa"
},
{
"paper": "Gene Array Profiling and Immunomodulation Studies Define a Cell-Mediated Immune Response Underlying the Pathogenesis of Alopecia Areata in a Mouse Model and Humans",
"n_hits": 3,
"quote": "0 Hair basic keratin 1 (Hb1) KRTHB1: keratin, hair, basic, 1 ± 28 X99141 Hb3 KRTHB3: keratin, hair, basic, 3 ± 17 X99140 Hb5 KRTHB5: keratin, hair, basic, 5 ± 32 Z19574 K17 KRT17: keratin 17 ± 5 X12876 K18 KRT18: keratin 18 ± 4.3 X07696 High-sulfur keratin 1 KRT15: keratin 15 ± 7.3 U42408 Ladinin LA"
},
{
"paper": "Periplaneta americana extract (L.) promotes hair regrowth in Alopecia areata mice by reducing inflammation and modulating skin microbiota",
"n_hits": 2,
"quote": "Vibrionaceae_Vibrio was positively correlated with mt-Co1, mt- Cytb, mt-Nd1, mt-Nd4, and mt-Nd5; Jeotgalicoccus was positively correlated with mt-Cytb, mt-Nd2, mt-Nd4, mt-Nd5, and Krt17; Aerococcus was positively correlated with mt-Nd5 and Krt17; Streptococcus was positively correlated with B2m, Tpt"
}
],
"LAMA5": [
{
"paper": "Laminin-511, inducer of hair growth, is down-regulated and its suppressor in hair growth, laminin-332 up-regulated in chemotherapy-induced alopecia",
"n_hits": 110,
"quote": "Laminin-511, inducer of hair growth, is down-regulated and its suppressor in hair growth, laminin-332 up-regulated in chemotherapy-induced alopecia Hisayoshi Imanishia, Daisuke Tsurutaa,*, Ch"
},
{
"paper": "Genetic analysis of a novel antioxidant multi-target iron chelator, M30 protecting against chemotherapy-induced alopecia in mice",
"n_hits": 8,
"quote": "ved from skin biopsy specimens of normal mice, cyclophosphamide-treated mice, and cyclophosphamide treated mice with M30 supplement. Results: The top genes namely Tnfrsf19, Ercc2, Lama5, Ctsl, and Per1 were identified by microarray analysis. These genes were found to be involved in the biological pr"
},
{
"paper": "A missense mutation in Lama3 causes androgen alopecia",
"n_hits": 7,
"quote": "_034810.1: p.Arg217Cys). This is an unreported SNP locus that is completely linked to the phenotype. Laminin, a major component of the basement membrane, includes three isoforms, laminin-511, laminin-332, and laminin-211, and the Lama3 gene encodes the alpha subunit of laminin-332. Basement mem- bra"
},
{
"paper": "Molecular signatures and signaling interactions of the hair follicle stem cell niche.",
"n_hits": 2,
"quote": "HGSC-specific ligand Shh, in addition to potential interaction with Hhip and Gpc5, may bind to both Ptch1/Smo and Ptch2/Smo in the DP (Hsu et al., 2014) (Figure 6e). HG-DP pairs Lama5→Sdc1, Lama5→Itgb1, Thbs1→Itgb1 and Thbs1→Lrp1 might regulate DP structural integrity (Hoffman et al., 1998, Resovi e"
}
],
"VDR": [
{
"paper": "Gene therapy for alopecia in type II rickets model rats using vitamin D receptor-expressing adenovirus vector",
"n_hits": 239,
"quote": "iyu Nishikawa 1, Shinichi Ikushiro 1, Tomoko Nakanishi 3, Shigeto Sato 3, Kaori Yasuda 1 & Toshiyuki Sakaki 1* Type II rickets is a hereditary disease caused by a mutation in the vitamin D receptor (VDR) gene. The main symptoms of this disease are bone dysplasia and alopecia. Bone dysplasia can be a"
},
{
"paper": "Targeted Expression of Human Vitamin D Receptor in the Skin Promotes the Initiation of the Postnatal Hair Follicle Cycle and Rescues the Alopecia in Vitamin D Receptor Null Mice",
"n_hits": 124,
"quote": "Targeted Expression of Human Vitamin D Receptor in the Skin Promotes the Initiation of the Postnatal Hair Follicle Cycle and Rescues the Alopecia in Vitamin D Receptor Null Mice Juan Kong, Xiao Jian Li,² Donna Gavin,² Yulei Jia"
},
{
"paper": "Targeted ablation of the vitamin D receptor An animal model of vitamin D-dependent rickets type II withalopecia",
"n_hits": 45,
"quote": "Proc. Natl. Acad. Sci. USA Vol. 94, pp. 98319835, September 1997 Medical Sciences Targeted ablation of the vitamin D receptor: An animal model of vitamin D-dependent rickets type II with alopecia YAN CHUN LI*, ALISON E. PIRRO*, MICHAEL AMLING†‡, GUNTER DELLING‡, ROLAND BARON†, RODERICK BRONSON§, AN"
},
{
"paper": "Vitamin D3 Analogs Stimulate Hair Growth in Nude Mice",
"n_hits": 22,
"quote": "Pharmaceuticals (L.B.), DK-2750 Ballerup, Denmark The active form of vitamin D3 can regulate epidermal kera- tinization by inducing terminal differentiation; and mice lacking the vitamin D receptor display defects leading to post- natal alopecia. These observations implicate the vitamin D3 pathway i"
}
],
"PPARG": [
{
"paper": "Hair Follicle Stem Cell-Specific PPARγ Deletion Causes Scarring Alopecia",
"n_hits": 128,
"quote": "Hair Follicle Stem Cell-Specific PPARγ Deletion Causes Scarring Alopecia Pratima Karnik1, Zenar Tekeste1, Thomas S. McCormick1, Anita C. Gilliam1, Vera H. Price2, Kevin D. Cooper1, and Paradi Mirmirani1 1Department of"
},
{
"paper": "Promotion of Hair Regrowth in Androgenetic Alopecia with Supplemented Erzhi Wan Exploring Its Mechanism Using Network Pharmacology and Molecular Docking",
"n_hits": 12,
"quote": "ylorobol NOS2 Mohanlian MOL003389 3-O-Methylorobol PTGS1 Mohanlian MOL003389 3-O-Methylorobol ESR1 Mohanlian MOL003389 3-O-Methylorobol AR Mohanlian MOL003389 3-O-Methylorobol PPARG Mohanlian MOL003389 3-O-Methylorobol PTGS2 Mohanlian MOL003389 3-O-Methylorobol ESR2 Mohanlian MOL003389 3-O-Me"
},
{
"paper": "Alleviation of Androgenetic Alopecia with Aqueous Paeonia lactiflora and Poria cocos Extract Intake through Suppressing the Steroid Hormone and Inflammatory Pathway",
"n_hits": 7,
"quote": "the opposite pattern with increasing aromatase mRNA expression (p < 0.05). In the dorsal skin, DKK1 and NR3C2 mRNA expressions were significantly lower, but TGF-β2, β-Catenin, and PPARG expressions were higher in the AGA-PL and AGA-PC groups than in the AGA-Con group (p < 0.05), whereas TNF-α and IL-"
},
{
"paper": "Prostaglandin D2 Inhibits Hair Growth and Is Elevated in Bald Scalp of Men with Androgenetic Alopecia",
"n_hits": 6,
"quote": "cularly relevant; although this eicosanoid has been hypothesized to be a natural ligand for the nuclear hormone transcription factor peroxisome proliferatorsactivated receptor γ (PPARγ), the measured concentration of 15-dPGJ2 is often lower than the binding constant for PPARγ (17). Thus, although i"
}
],
"HR": [
{
"paper": "A missense mutation in Lama3 causes androgen alopecia",
"n_hits": 35,
"quote": "netic alopecia have caused serious disturbances to normal human life. Animal models play an important role in exploring pathogenesis of disease and evaluating new therapies. NIH hairless mice are a spontaneous hairless mouse discovered and bred in our laboratory. In this study, we resequenced the ge"
},
{
"paper": "Selective Expansion of Tregs Using the IL-2 Cytokine Antibody Complex Does Not Reverse Established Alopecia Areata in C3H HeJ Mice",
"n_hits": 6,
"quote": "on this, we tested the therapeutic potential of expanded Tregs in AA using the C3H/HeJ mouse model. In mice with AA, NKG2D- expressing CD8 T cells widely infiltrate both haired and hairless skin areas, which have tissue-resident memory T-cell phenotypes. Tregs in the skin express CD25, CTLA-4, GATA-3"
},
{
"paper": "Vitamin D3 Analogs Stimulate Hair Growth in Nude Mice",
"n_hits": 6,
"quote": "nactivating mutation of VDR, with either partial or total alopecia (26). Studies using VDR knockout mice have shown that keratinocytes are the aberrant cells responsible for their hairless phenotype (23, 27). Keratinocytes express Whn, and hair reconstitution assays revealed them to be the defective"
},
{
"paper": "Gene therapy for alopecia in type II rickets model rats using vitamin D receptor-expressing adenovirus vector",
"n_hits": 4,
"quote": "have demonstrated that complex formation by VDR and other factors in keratinocytes is essential for the maintenance of the hair ­cycle16,17. In addition, the interaction between Hairless and the VDR-RXR complex may be essential for the regulation of hair follicle cycling, including the hedgehog sign"
}
],
"SOX9": [
{
"paper": "Disrupted cholesterol biosynthesis and hair follicle stem cell impairment in the onset of alopecia",
"n_hits": 48,
"quote": "eported as means with standard deviation, and a P-value below 0.05 was considered statistically significant 3. Results 3.1. Down-regulated expression of stem cell marker genes (SOX9, LGR5, SHH, WNT 5A) in PCA A gene expression study using real-time PCR data showed that hair follicle stem cell marker"
},
{
"paper": "JAK-STAT1 as therapeutic target for EGFR deficiency-associated inflammation and scarring alopecia",
"n_hits": 30,
"quote": "ig. 1H). Skin sections and epidermal whole mounts of older mice (57 M) indicated the complete degradation of the hair follicle structure together with the stem cell markers CD34, Sox9, and Krt15 (Figs. 1I and EV1F). These data demonstrate that hair follicle-specific EGFR protects from microbiota-dri"
},
{
"paper": "Tremella polysaccharide microneedles loaded with magnetic dental pulp stem cell intracellular vesicles used for androgenic alopecia",
"n_hits": 24,
"quote": "(2025) 16:161 PVDF membrane was sealed with 5% skim milk and incubated with primary antibody at 4 °C for 15 h, including anti-CD206(Proteintech,60143-1-Ig,1:2000), anti-SOX9(Proteintech,67439-1-Ig,1:2000),anti- iNOS(Proteintech,18985-1-AP,1:2000), anti-TSG101 (Proteintech, 67381-1-Ig, 1: 1000), anti"
},
{
"paper": "Engineered collagen XVII-loaded dissolving microneedle patch for promoting hair regrowth in androgenic alopecia",
"n_hits": 22,
"quote": "sed follicle density, anagen-phase transition and CD31þ vascularization. Histological analysis revealed restored follicle structure and upregulated β-cateninþ and SRY-box gene 9 (SOX9þ), indicating activation of stem cell and prolif­ erative signaling pathways. The rhCOL17p-MN also demonstrated low "
}
],
"LGR5": [
{
"paper": "Disrupted cholesterol biosynthesis and hair follicle stem cell impairment in the onset of alopecia",
"n_hits": 76,
"quote": "treated with 25mM 7 DHC, 4mM BM15766 for 24 hours. The cells then underwent washing, fixing, and permeabilization [19] and were incubated with targeted primary antibodies SOX 9, LGR5, and Wnt 5A, purchased from ImmunoTag (St. Louis, MO, USA, Cat# ITT02816). Subsequently, the cells were exposed to DA"
},
{
"paper": "Modified Huanjingjian Prevents Chemotherapy-Induced Alopecia by Inhibiting Genomic DNA Methylation of the Wnt Signaling Pathway in Mice",
"n_hits": 16,
"quote": "in each at room temperature. Subsequently, the sections were incubated at 37 °C for 45 min with primary antibodies diluted in IF blocking buffer. The primary antibodies included: Lgr5 (ab273092), CD49f (Integrin α6, ab181551), SOX9 (ab185966), S100A4 (ab93283), CK15 (ab52816), and FZD10 (ab137491) ("
},
{
"paper": "Low-frequency electromagnetic fields ameliorate testosterone-induced androgenetic alopecia in mice through LncRNA H19 miR-214-5p β-catenin signal pathway",
"n_hits": 12,
"quote": "emerge from the tissue (10 9 10); D Day 7 after primary culture (scattered HFSCs, 10 9 10); E: 1st generation; F 2nd generation; G Identification of HFSCs by flow cytometry using LGR5 (+), CD200 (+), CD271 (), and CK15 () as markers. J.-H. Cheng et al."
},
{
"paper": "Molecular signatures and signaling interactions of the hair follicle stem cell niche.",
"n_hits": 10,
"quote": "Invest Dermatol. Author manuscript; available in PMC 2026 February 06. Author Manuscript Author Manuscript Author Manuscript Author Manuscript 2005) and Wnt signaling co-receptor Lgr5 (Jaks et al., 2008) were expressed in the Core and 3-Zones signatures (Figure 4c, Supplementary Figure S7a and b). F"
}
],
"CD34": [
{
"paper": "JAK-STAT1 as therapeutic target for EGFR deficiency-associated inflammation and scarring alopecia",
"n_hits": 55,
"quote": "SOS expression and antibiotic therapy (Abx) prevented visible hair loss between 2 and 5 months of age in EGFRΔep mice (Fig. 1A). Additional FACS analysis revealed the loss of the CD34 positive hair follicle stem cell (HFSC) niche preceding macroscopic hair loss (Figs. 1A,B and EV1A for overall FACS "
},
{
"paper": "Secretory phospholipase A2-IIA overexpressing mice exhibit cyclic alopecia mediated through aberrant hair shaft differentiation and impaired wound healing response",
"n_hits": 12,
"quote": "ferentiation. Therefore, we attempted to understand the profile of hair follicle stem cells. We performed FACS analysis by using the mouse hair follicle stem cell markers such as CD34 and α6 integrin. Our results showed drastic depletion of CD34+/α6 integrin+ hair follicle stem cells at PD28 (Fig. 3"
},
{
"paper": "Ox40-Cremediated deletion of BRD4 reveals an unexpected phenotype of hair follicle stem cells in alopecia",
"n_hits": 9,
"quote": "confined to the skin. Surprisingly, we found substantial Ox40-Cre activities and consequently YFP expression in the skin (Figure 2C). In fact, YFP was expressed at high levels in CD34+ follicle stem cells, as well as in cell types derived from such stem cells, which include the epidermal cells, hair"
},
{
"paper": "ISEV2025 Abstract Book.",
"n_hits": 8,
"quote": "e analysed by flow cytometry. Cardiac function was evaluated via echocardiography before and after sepsis induction. Results: ECFCs exhibited endothelial progenitor markers (CD31, CD34, VCAM), and ECFC-EVs expressed both CD31 and the vesicular marker CD63. In vitro exposure to LPS significantly upre"
}
],
"BRD4": [
{
"paper": "Ox40-Cremediated deletion of BRD4 reveals an unexpected phenotype of hair follicle stem cells in alopecia",
"n_hits": 84,
"quote": "d: October 13, 2022 Published: December 8, 2022 Reference information: JCI Insight. 2022;7(23):e164534. https://doi.org/10.1172/jci. insight.164534. Ox40-Cremediated deletion of BRD4 reveals an unexpected phenotype of hair follicle stem cells in alopecia Mou Wen,1,2 Yuanlin Ying,1 Xiang Xiao,1 Pres"
},
{
"paper": "2,5-Diazabicyclo[2.2.1]heptane in medicinal chemistry a treasure trove of therapeutic opportunities.",
"n_hits": 7,
"quote": "interaction with 5-HT1A suggests a degree of selectivity toward 5-HT7 within the limited receptor panel evaluated.172 In 2016, Gerstenberger et al. designed several modulators of bromodomain with compounds housing the 2,5-DBH moiety.181 The ability of bromodomains to specifically identify ε-N-lysine"
}
],
"DNMT1": [
{
"paper": "Progressive alopecia reveals decreasing stem cell activation probability during aging of mice with epidermal deletion of DNA methyltransferase 1 (DNMT1)",
"n_hits": 67,
"quote": "Progressive alopecia reveals decreasing stem cell activation probability during aging of mice with epidermal deletion of DNA methyltransferase 1 (DNMT1) Ji Li1,2, Ting-Xin Jiang1, Michael W. Hughes1, Ping Wu1, Randall B Widelitz1, Guoping Fan3, and Cheng-Ming Chuong1,* 1Department of Pathology, Keck"
},
{
"paper": "Modified Huanjingjian Prevents Chemotherapy-Induced Alopecia by Inhibiting Genomic DNA Methylation of the Wnt Signaling Pathway in Mice",
"n_hits": 9,
"quote": "ated in AGA.33 The global DNA hypermethylation of the peripheral blood monocytes in patients with alopecia was observed, and the transcription level of DNA methyl­ transferase 1 (DNMT1) significantly increased.34 As for DNMT1, evidence shows that it plays an important role in the renewal and differe"
}
],
"NOX4": [
{
"paper": "A Natural Inhibitor, 1S-1-Acetoxychavicol Acetate, Against Testosterone-Induced Alopecia via NADPH Oxidase Regulation",
"n_hits": 14,
"quote": "H.; Bae, D.-W.; Park, S.-B.; Kwack, M.H.; Cha, S.-S.; Jang, D.S.; Sung, Y.K.; et al. A Natural Inhibitor, 1S-1-Acetoxychavicol Acetate, Against Testosterone-Induced Alopecia via NADPH Oxidase Regulation. Molecules 2025, 30, 2246. https://doi.org/10.3390/ molecules30102246 Copyright: © 2025 by the "
},
{
"paper": "Overcoming the Low Bioavailability of Apigenin The Therapeutic Efficacy for Androgenetic Alopecia Through Topical Administration",
"n_hits": 14,
"quote": "ed in Table 1. Except for Aldo-­keto reductase family 1, member B1 (AKR1B1) and Xanthine dehydrogenase (XDH), all the others are related to skin disease. Moreover, six of them (NADPH oxidase 4 (NOX4) (Jeon et al. 2023), cyclin-­dependent kinase 5 (CDK5) (Zhai et al. 2018), cytochrome P450 19A1 (CYP1"
},
{
"paper": "Extracellular vesicles in age-related diseases disease pathogenesis, intervention, and biomarker.",
"n_hits": 3,
"quote": "ing revealed that these sEVs are enriched with miR-100a-5p, which targets the 3 untranslated region (UTR) of nico- tinamide adenine dinucleotide phosphate hydrogen oxi- dase 4 (NOX4). This targeting mitigates oxidative stress via NOX4-ROS-NRF2 axis [116]. The Bcl2 family, known for its role in apop"
},
{
"paper": "ISEV2025 Abstract Book.",
"n_hits": 2,
"quote": "s pathways. Damaged mitochondria, as the cargo of MVs, also facilitated MVsEV71 crossing the BBB. MVsEV71 crossing the BBB further induced mitochondrial damage and activated the NOX4-derived ROS pathway in U251 cells. Summary/Conclusion: Our findings suggested that MVs trans- ported EV71 virions a"
}
],
"GPX4": [
{
"paper": "Schizochytrium sp. Extracted Lipids Prevent Alopecia by Enhancing Antioxidation and Inhibiting Ferroptosis of Dermal Papilla Cells",
"n_hits": 41,
"quote": "the key subunits of γ-glutamyl cysteine synthase and is the first-rate limiting enzyme for GSH synthesis. Ferroptosis is controlled by the composition of glutathione peroxidase 4 (GPX4). GSH acted as the reaction substrate of GPx4, and its depletion, could cause ferroptosis [49]. Solute Carrier Famil"
},
{
"paper": "ISEV2025 Abstract Book.",
"n_hits": 36,
"quote": "her affects the physio- logical response of GBM recipient cells. EVs from TMZ-untreated U87MG cells increase the expression of apoptotic (caspases 3/8/9) and ferroptotic (CD71 and GPX4) markers in recipient U251MG cells, while promoting a decrease in cell death markers in U87MG. The inactivation and"
},
{
"paper": "Interdisciplinarity traditional Chinese medicine microneedles in skin disease treatment Recent advances and challenges.",
"n_hits": 8,
"quote": "egrating TCM active ingredients and modern transdermal technology, as summarized in Table 2 [27]. For the successful treatment of hypertrophic scar, Shang et al. created a novel ferroptosis-based nanoplatform (Fig. 12) [196]. As a drug carrier, the platform makes use of zeolitic imidazolate framewor"
},
{
"paper": "Rejuvenating senescent hair follicles a novel conjugated linoleic acid based nanovesicle approach to treat androgenic alopecia",
"n_hits": 2,
"quote": "arious growth factors and promote the proliferation of DPCs [33]. Zeng et al. discovered that various PUFAs could treat hair loss by exerting antioxidant effects and inhibiting ferroptosis in DPCs [34]. In our study, we identified that CLA not only promoted HDPCs proliferation but relieved the DHT- "
}
],
"HMOX1": [
{
"paper": "Schizochytrium sp. Extracted Lipids Prevent Alopecia by Enhancing Antioxidation and Inhibiting Ferroptosis of Dermal Papilla Cells",
"n_hits": 30,
"quote": "sis shows that the ferroptosis signaling pathway was signifi- cantly influenced by SEL. A total of five genes in ferroptosis were upregulated after the SEL treatment, including GCLM, HMOX1, SLC7A11, FTH1, and Homo_sapiens_newGene_19841 (Figure 4a). The glutamatecysteine ligase modifier subunit (GCLM, E"
},
{
"paper": "ISEV2025 Abstract Book.",
"n_hits": 15,
"quote": "with muscle invasiveness, and a trained classifier could predict UBC with 92% accuracy. Some 96 of 555 Journal of Extracellular Vesicles, 2025 differentially expressed proteins, HO-1 and MMP7, were analysed by bead-based flow cytometry, where HO-1 was detected on the EV surface. Summary/Conclusion: "
},
{
"paper": "Jiawei Erzhiwan Ameliorates Androgenetic Alopecia by Regulating the SIRT1 JNK p38 MAPK Pathway",
"n_hits": 13,
"quote": "ed the effects of DHT. To confirm our findings, we comparatively examined the levels of MDA, GSH and SOD (Figure 4FH), as well as the expression of cyclooxygenase 2 (COX-2) and heme oxygenase 1 (HO-1) (Figure 4I and J), in the dorsal skin of different murine groups. And the result provided similar "
},
{
"paper": "Interdisciplinarity traditional Chinese medicine microneedles in skin disease treatment Recent advances and challenges.",
"n_hits": 10,
"quote": ", as well as antioxidant activities [7375]. Notably, Rg3 can prevent oxidative stress damage to human skin fibroblasts by lowering ROS creation, raising NRF2, and encour­ aging heme oxygenase (HO-1) expression [76,77]. Furthermore, it has been reported that Rg3 can protect through its antioxidant c"
}
],
"CRH": [
{
"paper": "Corticotropin-releasing hormone inhibits autophagy by suppressing PTEN to promote apoptosis in dermal papilla cells",
"n_hits": 175,
"quote": "Research Article Annals of Medicine 2025, VOL. 57, NO. 1, 2490823 Corticotropin-releasing hormone inhibits autophagy by suppressing PTEN to promote apoptosis in dermal papilla cells Wenzi Lianga, Xiuwen Chenb, Na Nic, Chutong Zhuangc, Zhiying Yua, Ziqing Xua, Yingshi"
},
{
"paper": "CRF Receptor Antagonist Astressin-B Reverses and Prevents Alopecia in CRF Over-Expressing Mice",
"n_hits": 148,
"quote": "lifornia, United States of America, 4 Department of Molecular Microbiology and Immunology, Oregon Health & Sciences University, Portland, Oregon, United States of America Abstract Corticotropin-releasing factor (CRF) signaling pathways are involved in the stress response, and there is growing eviden"
},
{
"paper": "Research on the effects and preliminary mechanism of action of Shaoyao Gancao granule (芍药甘草颗粒) on hypothalamic-pituitary-adrenal axis and T lymphocytes in stressed alopecia areata mice",
"n_hits": 24,
"quote": "larmin, and compound glycyrrhizin (CG). On day 24, overall and trichoscopic photographs of mice were taken on day 24 of the experiment; behavioral tests were completed; serum corticotropin-releasing hormone (CRH), adrenocorticotropic hormone (ACTH), and cortisol levels were measured by enzyme-linked"
},
{
"paper": "Clinical Practice Guidelines for Menopause An Executive Summary and Recommendations Indian Menopause Society 2026.",
"n_hits": 3,
"quote": "upplementation. Table 3: Treatment recommendation based on bone mineral density/fracture risk assessment tool/osteoporosis selfassessment tool for Asians BMD Fracture risk BMD + CRF/ CRF by FRAX and or OSTA Treatment decision Choice of therapy Low bone mass Low TLM/reassess after 5 years TLM Low bo"
}
]
}